IGEM:IMPERIAL/2007/Projects/Cell by date/Implementation/List of Required Parts

From OpenWetWare
Revision as of 16:31, 31 July 2007 by Alexander.wong (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

DNA Constructs

pTet GFP

  • Registry part: BBa_I13522
  • Comments: Untagged GFP behind a constitutive promoter.
  • DNA Available in the registry


pT7 GFP

  • Registry part: BBa_J34814
  • T7 promoter sequence: gaatttaatacgactcactatagggaga
  • Comments: T7 Promoter to be used qith t7 polymerase BBa_J34811
  • DNA still in planning
  • pT7 sequence from Ambion:


pBad GFP

  • Registry part: BBa_J5528
  • Comments: Similar to part J5527 where mRFP is replaced with GFP
  • DNA Available in the registry
  • Allows tight control in E. coli


Generic Components

  • RBS (Elowitz)

BBa_B0034

Short description: This is the most efficient RBS in the registry, and sets the 1.0 efficiency standard. It is based on the Elowitz repressilator.


  • Double terminator (B0010-B0012)

BBa_B0015

Short description: Double terminator consisting of BBa_B0010 and BBa_B0012. This is the most commonly used terminator. It seems to be reliable.
-forward_efficiency: 0.984
-reverse_efficiency: 0.295

Other Materials

  • DsRed-Express


  • T7 RNApol

BBa_J34811

Short description: To be used with specal tRNA loading glutamate instead of stop codon (Part BBa_J34812).

  • tRNA loading Glutamate on stop codon TTT

BBA_J34812

Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:IMPERIAL/2007/Projects/Cell_by_date/Implementation/List_of_Required_Parts&oldid=136072"