
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m (Primers to be used for PCR)
Line 118: Line 118:
Forward: <b>GCTCTAG</b>ATGAGTCGTTTAGTCGTAG &nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 52.4C(without) and 63.2(with)<br>
Forward: <b>GCTCTAG</b>ATGAGTCGTTTAGTCGTAG &nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 52.4C(without) and 63.2(with)<br>
Backward: <b>GGACTAGTA</b>CTACGCAAGCTTTGGAAAG &nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 54.5C(without) and 65.1(with)<br>
Backward: <b>GGACTAGTA</b>CTACGCAAGCTTTGGAAAG &nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 54.5C(without) and 65.1(with)<br>
Strain to use:BL21(DE3)
<b>PAH Sequence:</b>
<b>PAH Sequence:</b>

Revision as of 10:52, 10 August 2009

Primers to be used for PCR

Considerations for primer design http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html

Use this website to calculate temperatures and modify primers and this one for reverse complement.

RcsB Sequence:


Forward: GCTCTAGATGAACAATATGAACGTAATTATTG       53.1C(without) and 61.8(with)
Backward: GGACTAGTATTAGTCTTTATCTGCCGG       51.4C(without) and 63.4(with)

Strains to use:DH10B/TOP10
OtsB Sequence:


Forward: GCTCTAGATGACAGAACCGTTAACCG       54.5C (without) & 64.8C (with)
Backward: GGACTAGTATTAGATACTACGACTAAACGAC       54.7C (without) & 64.2C (with)

Strains to use:BL21(DE3)
B3023 Sequence:


Forward: GCTCTAGATGACAAACCTGACACTG       51.4C(without) and 63.0(with)
Backward: GGACTAGTATCACGCCAACGGCAC       53.3C(without) and 66.1C(with)

Strains to use:BL21(DE3)

WaaL Sequence:


Forward: GCTCTAGATGCTAACATCCTTTAAACTTC       52.8C(without) and 62.4(with)
Backward: GGACTAGTATTAATTAATTGTATTGTTACGATTATTAATG       54.9C(without) and 62.3(with)

Strains to use:DH10B/TOP10
OtsA Sequence:


Forward: GCTCTAGATGAGTCGTTTAGTCGTAG       52.4C(without) and 63.2(with)
Backward: GGACTAGTACTACGCAAGCTTTGGAAAG       54.5C(without) and 65.1(with)

Strain to use:BL21(DE3)
PAH Sequence:


Forward: GCTCTAGATGTCCACTGCGGTCC       54.3C (without) & 66.0C (with)
Backward: GGACTAGTATTACTTTATTTTCTGGAGGGC       54.0C (without) & 64.0C (with)

Cellulase Sequence:


Forward: GCTCTAGATGAAAAAAATTGTTTCTTTGGTTTG       53.8C (without) & 62.0C (with)
Backward: GGACTAGTATTACCATCCAAGCTTGTTTTTTATTTC       57.4C (without) & 64.9C (with)

Dam Sequence:


Forward: GCTCTAGATGAAGAAAAATCGCGCTTTTTTG       55.9C (without) & 64.2C (with)
Backward: GGACTAGTATTATTTTTTCGCGGGTGAAAC       54.0C (without) & 64.0C (with)

Personal tools