IGEM:Imperial/2010/Output module/EGFP
From OpenWetWare
Notes on EGFP
- the N-terminal half of EGFP (1−128 amino acids; light gray) and C-terminal half of EGFP (129−238 amino acids; dark gray), respectively.
- in the article: Interacted protein A and protein B are linked to opposite ends of the split VDE. Interaction between protein A and protein B accelerates the folding of N- and C-terminal VDE and protein splicing occurs. The N- and C-terminal halves of EGFP are linked together by a normal peptide bond to yield the β-can structure (green), in which the fluorophore is formed.
- translation=
MVSKGEELFTGVVPILVELD GDVNGHKFSVSGEGEGDATY GKLTLKFICTTGKLPVPWPT LVTTLTYGVQCFSRYPDHMK QHDFFKSAMPEGYVQERTIF FKDDGNYKTRAEVKFEGDTL VNRIELKG (128aa) IDFKEDGNILGH KLEYNYNSHNVYIMADKQKN GIKVNFKIRHNIEDGSVQLA DHYQQNTPIGDGPVLLPDNH YLSTQSALSKDPNEKRDHMV LLEFVTAAGITLGMDELYK (239aa)
- nucleotide sequence=
61 atgg tgagcaaggg cgaggagctg 121 ttcaccgggg tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc 181 agcgtgtccg gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc 241 tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctacggc
301 gtgcagtgct tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc 361 atgcccgaag gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag 421 acccgcgccg aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc
481 atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc 541 cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc 601 cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc 661 atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg 721 agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc 781 gggatcactc tcggcatgga cgagctgtac aagtaa
Reference: EGFP on NCBI
- nucleotide sequence: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa
- the bacteria were allowed to express recombinant protein with IPTG for 3 h at 25 °C and 10 μL of LB medium containing the bacteria was streaked onto LB-agarose plates and incubated overnight at 25 °C. The bacteria on the plates were illuminated with blue-LED at 470 nm (LAS-1000plus, Fujifilm), emitting maximum at 510 nm, which was detected by a cooled CCD equipped with an emission filter (530DF30).