IGEM:MIT/2006/Notebook/2006-6-8

From OpenWetWare

< IGEM:MIT | 2006 | Notebook
Revision as of 16:39, 16 June 2006 by Skatebro (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

PRIMER INFORMATION FOR ORDERING

SAMT from A. Majus

checked by Reshma

<bbpart>BBa_J45001</bbpart>

PCR primers

Forward Strand

  • Sequence to order: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG ACA AAA CAA ACA CAA AAG C
  • Length of matching: 22 bp
  • GC content: 31.8%
  • Melt Temp. 51.0 C
  • Whole sequence analysis
    • Lowest secondary structure deltaG: -.93 kcal/mol
    • No significant homodimers or heterodimers

Reverse Strand

  • Sequence to order: 5'- GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAT TA GTT TCT TTT TGC TTG TCA CTC
  • Length of matching: 21 bp
  • GC content: 38.1.0%
  • Melt Temp. 50.4 C
  • Whole sequence analysis
    • Lowest secondary structure deltaG: -1.68 kcal/mol
    • No significant homodimers or heterodimers

BAMT from A. majus

<bbpart>BBa_J45002</bbpart> -- note, this part needs to be fixed up to remove noncoding region on 3' end and replace original stop codon with the TAATAA stop codon in the primers

PCR primers

checked by Reshma

Forward primers

  • Forward primer (5' -> 3'): GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG AAA GTG ATG AAG AAA C
    • Length: 47
    • GC Content: 31.6%
    • Melting Temp: 45.2

Reverse primers

  • Reverse primer (5' -> 3'): GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTA TTA TCT CCT ACT TAG AGA AAC TAC
    • Length: 56
    • GC Content: 38.1%
    • Melting Temp: 47.7

Mutagenesis primers

checked by Reshma

go with primer 3 ... they all look pretty good but may as well go with the slightly longer one

Primer pair 3

                                  *
   Forward: 5' CATTGCTTGCAAAAACACTGGTTGATATGGTGGCTGAG 3'
   Reverse: 5' CTCAGCCACCATATCAACCAGTGTTTTTGCAAGCAATG 3'
                                 *
    GC content: 44.74%           Location: 683-720
    Melting temp: 79.2°C         Mismatched bases: 1
    Length: 38 bp                Mutation: Substitution
    5' flanking region: 19 bp    Forward primer MW: 11772.77 Da
    3' flanking region: 18 bp    Reverse primer MW: 11581.68 Da

BSMT from P. x hybrida

Part <bbpart>BBa_J45004</bbpart> checked by Austin:

  • Sequence matches that of Genbank sequence AY233465
  • No double TAA stop codon in the part but primer does include it
  • Forward primer ok
  • Reverse primer ok
  • No mutations needed

PCR primers

Forward primer

Designed Forward Strand (1 and 2): 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG GAA GTT GTT GAA GTT C -3'

  • LENGTH: 19
  • GC CONTENT: 36.8 %
  • MELT TEMP: 47.8 °C

Reverse primer

Designed Reverse Strand (phBSMT1): 5'- GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAT TAA TTT ATT TTG GTC AAG GAG -3'

  • LENGTH: 22
  • GC CONTENT: 27.3 %
  • MELT TEMP: 46.6 °C

ATF1 from S. Cerevisiae

Part <bbpart>BBa_J45006</bbpart>

checked by Austin:

  • EcoRI mutation is silent mutation GAA->GAG
  • Sequence matches that of Genbank sequence Z75285
  • Double TAA stop codon
  • Forward primer ok
  • Reverse primer
    • The anneal length is only 16 bp not 19 as listed below. melt temp is even lower at 45.9
    • Also 3'-ends with sticky GG, I would add 2 more bases (AG) to 3' end
  • Mutation primers look ok

PCR primers

Forward primer

Designed forward primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG AAT GAA ATC GAT GAG -3'

  • Length: 46 bp
  • Length only anneal: 18
  • GC content: 33.3%
  • Melt temp: 44.2 deg. C
  • DeltaG hairpin: -1.52 kcal/mol
  • DeltaG homodimer: -91.97 kcal/mol


Reverse primer

Designed reverse primer: 5'- GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAT TAA GGG CCT AAA AGG -3'

  • Length: 48 bp
  • Length only anneal: 19
  • GC content: 36.8%
  • Melt temp: 46.5 deg. C
  • DeltaG hairpin: -2.73 kcal/mol
  • DeltaG homodimer: -96.09 kcal/mol

DeltaG heterodimer: -96.09 kcal/mol

Mutagenesis Primers

Primer pair 4

                                 *
   Forward: 5' GAAGCAAATATTAGAAGAGTTCAAAAATAGTAAGGG 3'
   Reverse: 5' CCCTTACTATTTTTGAACTCTTCTAATATTTGCTTC 3'
                                *
    GC content: 30.56%           Location: 396-431
    Melting temp: 72.5°C         Mismatched bases: 1
    Length: 36 bp                Mutation: Substitution
    5' flanking region: 18 bp    Forward primer MW: 11246.47 Da
    3' flanking region: 17 bp    Reverse primer MW: 10867.22 Da
Personal tools