IGEM:MIT/2006/Notebook/2006-7-24

Smell Experiments w/ Isoamyl Acetate

• Questions that we want to answer:
  1. Does IAA smell like banana? Yes
  2. Does IAA smell strongly in LB?
  3. At what IAA concentration can E. coli "normal" growth?
     • Culture Top10s and add different concentrations of IAA after cells reach OD ~ 0.5

osmY PCR

Done with each pair of new primers meant for PCRing both the short and long osmY promoter region.

• 45μL PCR SuperMix
• 2.5μL 0.55ng/μL E. coli genome
• 1.25μL each respective primer (25 ng/μL)

Did we get transformants using the annealed primers? NO! :(

pchB and pchA primers

• pchB forward: atgaaaactcccgaagactgcac