IGEM:MIT/2006/Notebook/2006-7-25: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
| Line 18: | Line 18: | ||
*1.25 uL SpeI | *1.25 uL SpeI | ||
==ATF1A and R0030 Digest== | ==ATF1A and R0030 Digest== | ||
Cut ATF1A with EcoRI and XbaI and R0030 EcoRI and SpeI | |||
==Order ATF1-A mutation primers== | ==Order ATF1-A mutation primers== | ||
Revision as of 09:54, 25 July 2006
IAA Smell Test
Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 .5ul was detectable, but .1ul (which we might get) was less detectable
- Tested today in preferred IK strains
Indole Knockouts
Out of 3 strains, the JC12337 did not smell as nice
- note, previous disappointment with IK stemmed from contaminated LB
Made glycerols of MB408 and MEB61
osmY-Trunc Eco/Spe Digest
- 5 uL Buffer 2
- 0.5 uL BSA
- 2 uL ~800 ng/uL Annealed osmY-Trunc primers
- 1.25 uL EcoRI
- 1.25 uL SpeI
ATF1A and R0030 Digest
Cut ATF1A with EcoRI and XbaI and R0030 EcoRI and SpeI
Order ATF1-A mutation primers
Primer pair 2
*
Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3'
Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3'
*
GC content: 41.46% Location: 214-254
Melting temp: 79.8°C Mismatched bases: 1
Length: 41 bp Mutation: Substitution
5' flanking region: 20 bp Forward primer MW: 12619.37 Da
3' flanking region: 20 bp Reverse primer MW: 12587.31 Da
