IGEM:MIT/2006/Notebook/2006-7-25: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
(10 intermediate revisions by 3 users not shown) | |||
Line 2: | Line 2: | ||
Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 | Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 | ||
.5ul was detectable, but .1ul (which we might get) was less detectable | .5ul was detectable, but .1ul (which we might get) was less detectable | ||
*Tested today in preferred IK strains = '''Good News''' | |||
**.1 μL IAA and .5 μL IAA smelled strongly and pleasantly of bananas in IK strains. It is reasonable to estimate that our ATF1 gene can generate in E. coli about this range of IAA | |||
**IK gave a huge improvement over the Top10 smell cultures | |||
==Indole Knockouts== | ==Indole Knockouts== | ||
Line 9: | Line 13: | ||
==osmY-Trunc Eco/Spe Digest== | ==osmY-Trunc Eco/Spe Digest== | ||
*5 uL Buffer 2 | |||
*0.5 uL BSA | |||
*2 uL ~800 ng/uL Annealed osmY-Trunc primers | |||
*1.25 uL EcoRI | |||
*1.25 uL SpeI | |||
==ATF1A*, R0030, R0032 Digests== | |||
#Cut ATF1A* with EcoRI and XbaI ---- 38 ng/μL | |||
#Cut R0030 with EcoRI and SpeI ---- 10 ng/μL | |||
#Cut R0032 with EcoRI and SpeI ---- 23 ng/μL | |||
==Order ATF1-A mutation primers== | |||
Primer pair 2 | |||
* | |||
Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3' | |||
Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3' | |||
* | |||
GC content: 41.46% Location: 214-254 | |||
Melting temp: 79.8°C Mismatched bases: 1 | |||
Length: 41 bp Mutation: Substitution | |||
5' flanking region: 20 bp Forward primer MW: 12619.37 Da | |||
3' flanking region: 20 bp Reverse primer MW: 12587.31 Da |
Latest revision as of 14:46, 25 July 2006
IAA Smell Test
Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 .5ul was detectable, but .1ul (which we might get) was less detectable
- Tested today in preferred IK strains = Good News
- .1 μL IAA and .5 μL IAA smelled strongly and pleasantly of bananas in IK strains. It is reasonable to estimate that our ATF1 gene can generate in E. coli about this range of IAA
- IK gave a huge improvement over the Top10 smell cultures
Indole Knockouts
Out of 3 strains, the JC12337 did not smell as nice
- note, previous disappointment with IK stemmed from contaminated LB
Made glycerols of MB408 and MEB61
osmY-Trunc Eco/Spe Digest
- 5 uL Buffer 2
- 0.5 uL BSA
- 2 uL ~800 ng/uL Annealed osmY-Trunc primers
- 1.25 uL EcoRI
- 1.25 uL SpeI
ATF1A*, R0030, R0032 Digests
- Cut ATF1A* with EcoRI and XbaI ---- 38 ng/μL
- Cut R0030 with EcoRI and SpeI ---- 10 ng/μL
- Cut R0032 with EcoRI and SpeI ---- 23 ng/μL
Order ATF1-A mutation primers
Primer pair 2
* Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3' Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3' * GC content: 41.46% Location: 214-254 Melting temp: 79.8°C Mismatched bases: 1 Length: 41 bp Mutation: Substitution 5' flanking region: 20 bp Forward primer MW: 12619.37 Da 3' flanking region: 20 bp Reverse primer MW: 12587.31 Da