IGEM:MIT/2006/Notebook/2006-7-25: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 15: | Line 15: | ||
*1.25 uL EcoRI | *1.25 uL EcoRI | ||
*1.25 uL SpeI | *1.25 uL SpeI | ||
==Order ATF1-A mutation primers== | |||
Primer pair 2 | |||
* | |||
Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3' | |||
Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3' | |||
* | |||
GC content: 41.46% Location: 214-254 | |||
Melting temp: 79.8°C Mismatched bases: 1 | |||
Length: 41 bp Mutation: Substitution | |||
5' flanking region: 20 bp Forward primer MW: 12619.37 Da | |||
3' flanking region: 20 bp Reverse primer MW: 12587.31 Da |
Revision as of 09:25, 25 July 2006
IAA Smell Test
Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 .5ul was detectable, but .1ul (which we might get) was less detectable
Indole Knockouts
Out of 3 strains, the JC12337 did not smell as nice
- note, previous disappointment with IK stemmed from contaminated LB
Made glycerols of MB408 and MEB61
osmY-Trunc Eco/Spe Digest
- 5 uL Buffer 2
- 0.5 uL BSA
- 2 uL ~800 ng/uL Annealed osmY-Trunc primers
- 1.25 uL EcoRI
- 1.25 uL SpeI
Order ATF1-A mutation primers
Primer pair 2
* Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3' Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3' * GC content: 41.46% Location: 214-254 Melting temp: 79.8°C Mismatched bases: 1 Length: 41 bp Mutation: Substitution 5' flanking region: 20 bp Forward primer MW: 12619.37 Da 3' flanking region: 20 bp Reverse primer MW: 12587.31 Da