IGEM:MIT/2006/Notebook/2006-7-25
From OpenWetWare
IAA Smell Test
Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 .5ul was detectable, but .1ul (which we might get) was less detectable
- Tested today in preferred IK strains
Indole Knockouts
Out of 3 strains, the JC12337 did not smell as nice
- note, previous disappointment with IK stemmed from contaminated LB
Made glycerols of MB408 and MEB61
osmY-Trunc Eco/Spe Digest
- 5 uL Buffer 2
- 0.5 uL BSA
- 2 uL ~800 ng/uL Annealed osmY-Trunc primers
- 1.25 uL EcoRI
- 1.25 uL SpeI
ATF1A, R0030, R0032 Digests
Cut ATF1A with EcoRI and XbaI ---- 38 ng/μL Cut R0030 with EcoRI and SpeI ---- 10 ng/μL Cut R0032 with EcoRI and SpeI ---- 23 ng/μL
Order ATF1-A mutation primers
Primer pair 2
* Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3' Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3' * GC content: 41.46% Location: 214-254 Melting temp: 79.8°C Mismatched bases: 1 Length: 41 bp Mutation: Substitution 5' flanking region: 20 bp Forward primer MW: 12619.37 Da 3' flanking region: 20 bp Reverse primer MW: 12587.31 Da