IGEM:MIT/2006/Notebook/2006-7-25

From OpenWetWare
Jump to navigationJump to search

IAA Smell Test

Added .1, .5, 1, 5, 10ul to 5ml liquid cultures of Top10 .5ul was detectable, but .1ul (which we might get) was less detectable

  • Tested today in preferred IK strains = Good News
    • .1 μL IAA and .5 μL IAA both smelled strongly and pleasantly of bananas in IK strains. It is reasonable to estimate that our ATF1 gene can generate in E. coli about this range of IAA
    • IK gave a huge improvement over the Top10 smell cultures

Indole Knockouts

Out of 3 strains, the JC12337 did not smell as nice

  • note, previous disappointment with IK stemmed from contaminated LB

Made glycerols of MB408 and MEB61

osmY-Trunc Eco/Spe Digest

  • 5 uL Buffer 2
  • 0.5 uL BSA
  • 2 uL ~800 ng/uL Annealed osmY-Trunc primers
  • 1.25 uL EcoRI
  • 1.25 uL SpeI

ATF1A*, R0030, R0032 Digests

  1. Cut ATF1A* with EcoRI and XbaI ---- 38 ng/μL
  2. Cut R0030 with EcoRI and SpeI ---- 10 ng/μL
  3. Cut R0032 with EcoRI and SpeI ---- 23 ng/μL

Order ATF1-A mutation primers

Primer pair 2

                                   *
   Forward: 5' CACCCCCTGGATAAGCGAATTTGACATGAATGATAACAAAG 3'
   Reverse: 5' CTTTGTTATCATTCATGTCAAATTCGCTTATCCAGGGGGTG 3'
                                   *
    GC content: 41.46%           Location: 214-254
    Melting temp: 79.8°C         Mismatched bases: 1
    Length: 41 bp                Mutation: Substitution
    5' flanking region: 20 bp    Forward primer MW: 12619.37 Da
    3' flanking region: 20 bp    Reverse primer MW: 12587.31 Da