IGEM:MIT/2006/Notebook/2006-8-3: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(23 intermediate revisions by 4 users not shown)
Line 1: Line 1:
==Today's big plan==
#design pchBA primers '''-done'''
#*pchB forward
#*pchA reverse
#*2 pchA mutagenesis
#PCR cleanup BAT2 and THI3 [nanodrop] '''-done'''
#miniprep overnight LCs [nanodrop] '''-done'''
#LC R0040-E0840 '''-done'''
#start digests -'''done: 11:30'''
#sequence correct (3) ATF1mut-Term assemblies '''-done'''
#*discard all ATF1mut-Term plates b/c we have an index plate '''-done'''
#autoclave waste '''-done'''
#pour plates (A/T, A) '''-done'''
#design gels (small wells for 3-part assemblies versus big wells for gel extracts) '''-done'''
#digest gel expectations????? '''-done'''
#heat shock digests '''-done'''
#load 3 digest product gels (and run THI3 again to get more DNA) '''-done'''
#PCR clean-ups on necessary digests [nanodrop] '''-done'''
#read digest gels and design ligations based on results '''-done'''
#gel extraction '''-done'''
#ligate (15 mins) '''-done'''
#design TH13 mutagenesis primers '''-done'''
#check all primers and email order to Heather '''-done'''
#transform '''-done'''
#label plates '''-done'''
#set a team meeting time '''-done'''
==Template Idea==
[[../../Template]]
==Primer To Do==
==Primer To Do==
#Order new pchBA primers
#Order new pchBA primers


==Miniprep/Digest To Do==
==Miniprep/Digest To Do==
#test osmY-E0840 with plate reader
#Miniprep BSMT.B0015 LC  
#Miniprep BSMT.B0015 LC  
#Cut BSMT.B0015 with XP
#Cut BSMT.B0015 with XP
Line 13: Line 42:
==WG Ligations/Transformations To Do==
==WG Ligations/Transformations To Do==
#Gel extract BSMT.B0015<sub>XP</sub>
#Gel extract BSMT.B0015<sub>XP</sub>
#Gel extract B0030<sub>SP</sub> backbone
#PCR Cleanup B0030<sub>SP</sub> backbone
#Ligate BSMT.B0015<sub>XP</sub> and B0030<sub>SP</sub> backbone-> transform  
#Ligate BSMT.B0015<sub>XP</sub> and B0030<sub>SP</sub> backbone-> transform  
<br>
<br>
Line 19: Line 48:
#Ligate B0030<sub>ES</sub> with BSMT.B0015<sub>XP</sub> in A/T<sub>EP</sub>
#Ligate B0030<sub>ES</sub> with BSMT.B0015<sub>XP</sub> in A/T<sub>EP</sub>


==osmY Ligations/Transformations To Do==
==osmY & E0840 Ligations/Transformations To Do==
#osmY and A/C<sub>EP</sub> and A/T<sub>EP</sub>
#osmY and A/C<sub>EP</sub> and A/T<sub>EP</sub>
#osmY cut with SpeI
#E0840 cut with XP
#Ligation of osmY cut with S and E0840 cut with XP and pSB1AK3 cut with EP


==ATF1 Miniprep/Digest To Do==
==ATF1 Miniprep/Digest To Do==
Line 29: Line 61:
==ATF1 Ligation/Transformation To Do==
==ATF1 Ligation/Transformation To Do==
#Ligate ATF1.B0015<sub>XP</sub> with B0030<sub>ES</sub> in A/C<sub>EP</sub> and A/T<sub>ESP</sub>
#Ligate ATF1.B0015<sub>XP</sub> with B0030<sub>ES</sub> in A/C<sub>EP</sub> and A/T<sub>ESP</sub>
==IAA Digest==
#BAT2 with EP, ligate with A/C and A/T<sub>EP</sub>
#THI3 with SX
#pSB1AK3 with SX
==IAA Ligations==
#BAT2<sub>EP</sub> w/ A/C & A/T BKB
#THI3<sub>SX</sub> w/ psBIAK3<sub>SX</sub>->A/K plate
==new pchBA primers==
*pchA reverse new: G TTT CTT TAC TAG TAT TAT Tag gcg acg ccg cgc tg  [melt temp = 65.6, no hairpin]
*pchB forward new: GTT TCT ACG AAT TCG CGG CCG CTT CTA Gat gaa aac tcc cga aga ctg cac
*pchA mut forward new: gat cga ccc att gga ccc gct '''a'''ca ggt att cgg tgc
*pchA mut reverse new: gca ccg aat acc tg'''t''' agc ggg tcc aat ggg tcg atc
*THI3 mut: possible problem...5 base pairs match up to create hairpin....
Primer pair 1
                              *
    Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3'
    Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3'
                              *
    GC content: 45.16%          Location: 40-70
    Melting temp: 75.2°C        Mismatched bases: 1
    Length: 31 bp                Mutation: Substitution
    5' flanking region: 15 bp    Forward primer MW: 9439.27 Da
    3' flanking region: 15 bp    Reverse primer MW: 9590.34 Da
Primer pair 2
                                *
    Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3'
    Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3'
                              *
    GC content: 46.88%          Location: 39-70
    Melting temp: 76.7°C        Mismatched bases: 1
    Length: 32 bp                Mutation: Substitution
    5' flanking region: 16 bp    Forward primer MW: 9768.48 Da
    3' flanking region: 15 bp    Reverse primer MW: 9879.53 Da
==Notes==
Poor Nanodrop turnouts => don't use PSB1AK3 and B0032

Latest revision as of 18:32, 3 August 2006

Today's big plan

  1. design pchBA primers -done
    • pchB forward
    • pchA reverse
    • 2 pchA mutagenesis
  2. PCR cleanup BAT2 and THI3 [nanodrop] -done
  3. miniprep overnight LCs [nanodrop] -done
  4. LC R0040-E0840 -done
  5. start digests -done: 11:30
  6. sequence correct (3) ATF1mut-Term assemblies -done
    • discard all ATF1mut-Term plates b/c we have an index plate -done
  7. autoclave waste -done
  8. pour plates (A/T, A) -done
  9. design gels (small wells for 3-part assemblies versus big wells for gel extracts) -done
  10. digest gel expectations????? -done
  11. heat shock digests -done
  12. load 3 digest product gels (and run THI3 again to get more DNA) -done
  13. PCR clean-ups on necessary digests [nanodrop] -done
  14. read digest gels and design ligations based on results -done
  15. gel extraction -done
  16. ligate (15 mins) -done
  17. design TH13 mutagenesis primers -done
  18. check all primers and email order to Heather -done
  19. transform -done
  20. label plates -done
  21. set a team meeting time -done

Template Idea

[[../../Template]]

Primer To Do

  1. Order new pchBA primers

Miniprep/Digest To Do

  1. Miniprep BSMT.B0015 LC
  2. Cut BSMT.B0015 with XP
  3. Miniprep B0030
  4. Cut B0030 with ES and SP(bkb)
  5. Miniprep R0040
  6. Cut R0040 with ES and SP(bkb)

WG Ligations/Transformations To Do

  1. Gel extract BSMT.B0015XP
  2. PCR Cleanup B0030SP backbone
  3. Ligate BSMT.B0015XP and B0030SP backbone-> transform


  1. Ligate B0030ES with BSMT.B0015XP in A/CEP
  2. Ligate B0030ES with BSMT.B0015XP in A/TEP

osmY & E0840 Ligations/Transformations To Do

  1. osmY and A/CEP and A/TEP
  2. osmY cut with SpeI
  3. E0840 cut with XP
  4. Ligation of osmY cut with S and E0840 cut with XP and pSB1AK3 cut with EP

ATF1 Miniprep/Digest To Do

  1. Miniprep ATF1.B0015 LC
  2. Cut ATF1.B0015 with XP
  3. Gel extract some of ATF1.B0015XP

ATF1 Ligation/Transformation To Do

  1. Ligate ATF1.B0015XP with B0030ES in A/CEP and A/TESP

IAA Digest

  1. BAT2 with EP, ligate with A/C and A/TEP
  2. THI3 with SX
  3. pSB1AK3 with SX

IAA Ligations

  1. BAT2EP w/ A/C & A/T BKB
  2. THI3SX w/ psBIAK3SX->A/K plate

new pchBA primers

  • pchA reverse new: G TTT CTT TAC TAG TAT TAT Tag gcg acg ccg cgc tg [melt temp = 65.6, no hairpin]
  • pchB forward new: GTT TCT ACG AAT TCG CGG CCG CTT CTA Gat gaa aac tcc cga aga ctg cac
  • pchA mut forward new: gat cga ccc att gga ccc gct aca ggt att cgg tgc
  • pchA mut reverse new: gca ccg aat acc tgt agc ggg tcc aat ggg tcg atc
  • THI3 mut: possible problem...5 base pairs match up to create hairpin....

Primer pair 1 

                              *
   Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3'
   Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3'
                              *
    GC content: 45.16%           Location: 40-70
    Melting temp: 75.2°C         Mismatched bases: 1
    Length: 31 bp                Mutation: Substitution
    5' flanking region: 15 bp    Forward primer MW: 9439.27 Da
    3' flanking region: 15 bp    Reverse primer MW: 9590.34 Da

Primer pair 2 

                               *
   Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3'
   Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3'
                              *
    GC content: 46.88%           Location: 39-70
    Melting temp: 76.7°C         Mismatched bases: 1
    Length: 32 bp                Mutation: Substitution
    5' flanking region: 16 bp    Forward primer MW: 9768.48 Da
    3' flanking region: 15 bp    Reverse primer MW: 9879.53 Da

Notes

Poor Nanodrop turnouts => don't use PSB1AK3 and B0032

Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:MIT/2006/Notebook/2006-8-3&oldid=56871"