IGEM:MIT/2006/Notebook/2006-8-3: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 76: | Line 76: | ||
*pchA mut forward new: gat cga ccc att gga ccc gct '''a'''ca ggt att cgg tgc | *pchA mut forward new: gat cga ccc att gga ccc gct '''a'''ca ggt att cgg tgc | ||
*pchA mut reverse new: gca ccg aat acc tg'''t''' agc ggg tcc aat ggg tcg atc | *pchA mut reverse new: gca ccg aat acc tg'''t''' agc ggg tcc aat ggg tcg atc | ||
*THI3 mut: | |||
Primer pair 1 | |||
* | |||
Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3' | |||
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3' | |||
* | |||
GC content: 45.16% Location: 40-70 | |||
Melting temp: 75.2°C Mismatched bases: 1 | |||
Length: 31 bp Mutation: Substitution | |||
5' flanking region: 15 bp Forward primer MW: 9439.27 Da | |||
3' flanking region: 15 bp Reverse primer MW: 9590.34 Da | |||
Primer pair 2 | |||
* | |||
Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3' | |||
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3' | |||
* | |||
GC content: 46.88% Location: 39-70 | |||
Melting temp: 76.7°C Mismatched bases: 1 | |||
Length: 32 bp Mutation: Substitution | |||
5' flanking region: 16 bp Forward primer MW: 9768.48 Da | |||
3' flanking region: 15 bp Reverse primer MW: 9879.53 Da | |||
==Notes== | ==Notes== | ||
Poor Nanodrop turnouts => don't use PSB1AK3 and B0032 | Poor Nanodrop turnouts => don't use PSB1AK3 and B0032 |
Revision as of 12:31, 3 August 2006
Today's big plan
- design pchBA primers -done
- pchB forward
- pchA reverse
- 2 pchA mutagenesis
- PCR cleanup BAT2 and THI3 [nanodrop] -done
- miniprep overnight LCs [nanodrop] -done
- LC R0040-E0840 -done
- start digests -done: 11:30
- sequence correct (3) ATF1mut-Term assemblies -done
- discard all ATF1mut-Term plates b/c we have an index plate -done
- autoclave waste -done
- pour plates (A/T, A) -done
- design gels (small wells for 3-part assemblies versus big wells for gel extracts) -done
- digest gel expectations????? -done
- heat shock digests -done
- load 3 digest product gels (and run THI3 again to get more DNA) -done
- PCR clean-ups on necessary digests [nanodrop] -done
- read digest gels and design ligations based on results
- gel extraction
- ligate (15 mins)
- design TH13 mutagenesis primers
- check all primers and email order to Heather
- transform
- label plates
- plan 8/4 and set a team meeting time
Template Idea
[[../../Template]]
Primer To Do
- Order new pchBA primers
Miniprep/Digest To Do
- Miniprep BSMT.B0015 LC
- Cut BSMT.B0015 with XP
- Miniprep B0030
- Cut B0030 with ES and SP(bkb)
- Miniprep R0040
- Cut R0040 with ES and SP(bkb)
WG Ligations/Transformations To Do
- Gel extract BSMT.B0015XP
- PCR Cleanup B0030SP backbone
- Ligate BSMT.B0015XP and B0030SP backbone-> transform
- Ligate B0030ES with BSMT.B0015XP in A/CEP
- Ligate B0030ES with BSMT.B0015XP in A/TEP
osmY & E0840 Ligations/Transformations To Do
- osmY and A/CEP and A/TEP
- osmY cut with SpeI
- E0840 cut with XP
- Ligation of osmY cut with S and E0840 cut with XP and pSB1AK3 cut with EP
ATF1 Miniprep/Digest To Do
- Miniprep ATF1.B0015 LC
- Cut ATF1.B0015 with XP
- Gel extract some of ATF1.B0015XP
ATF1 Ligation/Transformation To Do
- Ligate ATF1.B0015XP with B0030ES in A/CEP and A/TESP
IAA Digest
- BAT2 with EP, ligate with A/C and A/TEP
- THI3 with SX
- pSB1AK3 with SX
IAA Ligations
- BAT2EP w/ A/C & A/T BKB
- THI3SX w/ psBIAK3SX->A/K plate
new pchBA primers
- pchA reverse new: G TTT CTT TAC TAG TAT TAT Tag gcg acg ccg cgc tg [melt temp = 65.6, no hairpin]
- pchB forward new: GTT TCT ACG AAT TCG CGG CCG CTT CTA Gat gaa aac tcc cga aga ctg cac
- pchA mut forward new: gat cga ccc att gga ccc gct aca ggt att cgg tgc
- pchA mut reverse new: gca ccg aat acc tgt agc ggg tcc aat ggg tcg atc
- THI3 mut:
Primer pair 1
* Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3' Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3' * GC content: 45.16% Location: 40-70 Melting temp: 75.2°C Mismatched bases: 1 Length: 31 bp Mutation: Substitution 5' flanking region: 15 bp Forward primer MW: 9439.27 Da 3' flanking region: 15 bp Reverse primer MW: 9590.34 Da
Primer pair 2
* Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3' Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3' * GC content: 46.88% Location: 39-70 Melting temp: 76.7°C Mismatched bases: 1 Length: 32 bp Mutation: Substitution 5' flanking region: 16 bp Forward primer MW: 9768.48 Da 3' flanking region: 15 bp Reverse primer MW: 9879.53 Da
Notes
Poor Nanodrop turnouts => don't use PSB1AK3 and B0032