IGEM:MIT/2006/Notebook/2006-8-9: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(3 intermediate revisions by 2 users not shown) | |||
Line 4: | Line 4: | ||
==Our New Biobricks!== | ==Our New Biobricks!== | ||
Let's give a big warm welcome to: | Let's give a big warm welcome to: | ||
#J45100 (Prom40+RBS30+BSMT+Term15) | #J45100 (Prom40+RBS30+BSMT+Term15) [A/T] | ||
#J45120 (Prom40+RBS32+BSMT+Term15) | #J45120 (Prom40+RBS32+BSMT+Term15) [A/T] | ||
#J45170 (PromOS+RBS32+BSMT+Term15) | #J45170 (PromOS+RBS32+BSMT+Term15) [A/T] | ||
#J45200 (Prom40+RBS30+ATF1+Term15) | #J45200 (Prom40+RBS30+ATF1+Term15) [A/T] | ||
#J45220 (Prom40+RBS32+ATF1+Term15) | #J45220 (Prom40+RBS32+ATF1+Term15) [A/T] | ||
We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme: | We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme: | ||
#J45098 (BSMT+Term15) [A/K] | |||
#J45099 (RBS30+BSMT+Term15) [A/T] | |||
#J45119 (RBS32+BSMT+Term15) [A/T] | |||
#J45199 (RBS30+ATF1+Term15) [A or A/K] | |||
#J45219 (RBS32+ATF1+Term15) [A or A/K] | |||
# | And, there are always our coding regions... | ||
# | #J45001 (SAMT) [A] | ||
# | #J45002 (BAMT) [A] | ||
#J45004 (BSMT) [A] | |||
# | #J45008 (BAT2 with SpeI site) [A/T] | ||
#J45014 (ATF1 with mutation to eliminate EcoRI, but still has a random mutation) [A] | |||
# | |||
J453xx, 4xx etc will be for the next devices we build. | J453xx, 4xx etc will be for the next devices we build. | ||
Line 27: | Line 31: | ||
#*remember ATF1 parts prob have 2 RBS | #*remember ATF1 parts prob have 2 RBS | ||
#SMELL LCs (and miniprep plus sequence promising ones) | #SMELL LCs (and miniprep plus sequence promising ones) | ||
#*remember that the ATF1 assembly is a mutant version | #*remember that the ATF1 assembly is a mutant version [J45014] | ||
#ATF1 mutagenesis (??) | #ATF1 mutagenesis (??) | ||
#make LCs of pUCP22 cell colonies (LB Amp) | #make LCs of pUCP22 cell colonies (LB Amp) | ||
#make LCs of overnight transformants (all in LB A/T, some with SA or IA) | #make LCs of overnight transformants (all in LB A/T, some with SA or IA) | ||
==BAT2 mutation primers to eliminate SpeI== | |||
Primer pair 3 | |||
* | |||
Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3' | |||
Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3' | |||
* | |||
GC content: 54.55% Location: 32-64 | |||
Melting temp: 80.6°C Mismatched bases: 1 | |||
Length: 33 bp Mutation: Substitution | |||
5' flanking region: 16 bp Forward primer MW: 10187.73 Da | |||
3' flanking region: 16 bp Reverse primer MW: 10080.66 Da |
Latest revision as of 15:51, 9 August 2006
Smells!!!! : )
- the banana and wintergreen generating devices are assembled and WORKING!!! YAY!!! what an exciting day :-D
Our New Biobricks!
Let's give a big warm welcome to:
- J45100 (Prom40+RBS30+BSMT+Term15) [A/T]
- J45120 (Prom40+RBS32+BSMT+Term15) [A/T]
- J45170 (PromOS+RBS32+BSMT+Term15) [A/T]
- J45200 (Prom40+RBS30+ATF1+Term15) [A/T]
- J45220 (Prom40+RBS32+ATF1+Term15) [A/T]
We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:
- J45098 (BSMT+Term15) [A/K]
- J45099 (RBS30+BSMT+Term15) [A/T]
- J45119 (RBS32+BSMT+Term15) [A/T]
- J45199 (RBS30+ATF1+Term15) [A or A/K]
- J45219 (RBS32+ATF1+Term15) [A or A/K]
And, there are always our coding regions...
- J45001 (SAMT) [A]
- J45002 (BAMT) [A]
- J45004 (BSMT) [A]
- J45008 (BAT2 with SpeI site) [A/T]
- J45014 (ATF1 with mutation to eliminate EcoRI, but still has a random mutation) [A]
J453xx, 4xx etc will be for the next devices we build.
To do
- check 42 sample sequencing order in VectorNTI
- remember ATF1 parts prob have 2 RBS
- SMELL LCs (and miniprep plus sequence promising ones)
- remember that the ATF1 assembly is a mutant version [J45014]
- ATF1 mutagenesis (??)
- make LCs of pUCP22 cell colonies (LB Amp)
- make LCs of overnight transformants (all in LB A/T, some with SA or IA)
BAT2 mutation primers to eliminate SpeI
Primer pair 3
* Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3' Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3' * GC content: 54.55% Location: 32-64 Melting temp: 80.6°C Mismatched bases: 1 Length: 33 bp Mutation: Substitution 5' flanking region: 16 bp Forward primer MW: 10187.73 Da 3' flanking region: 16 bp Reverse primer MW: 10080.66 Da