IGEM:MIT/2006/Notebook/2006-8-9

Smells!!!! : )

• the banana and wintergreen generating devices are assembled and WORKING!!! YAY!!! what an exciting day :-D

Our New Biobricks!

Let's give a big warm welcome to:

1. J45100 (Prom40+RBS30+BSMT+Term15)
2. J45120 (Prom40+RBS32+BSMT+Term15)
3. J45170 (PromOS+RBS32+BSMT+Term15)
4. J45200 (Prom40+RBS30+ATF1+Term15)
5. J45220 (Prom40+RBS32+ATF1+Term15)

We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:

1. J45098 (BSMT+Term15)
2. J45099 (RBS30+BSMT+Term15)
3. J45119 (RBS32+BSMT+Term15)
4. J45198 (RBS30+ATF1)
5. J45199 (RBS30+ATF1+Term15)
6. J45218 (RBS32+ATF1)
7. J45219 (RBS32+ATF1+Term15)

J453xx, 4xx etc will be for the next devices we build.

To do

1. check 42 sample sequencing order in VectorNTI
   • remember ATF1 parts prob have 2 RBS
2. SMELL LCs (and miniprep plus sequence promising ones)
   • remember that the ATF1 assembly is a mutant version
3. ATF1 mutagenesis (??)
4. make LCs of pUCP22 cell colonies (LB Amp)
5. make LCs of overnight transformants (all in LB A/T, some with SA or IA)

BAT2 mutation primers to eliminate SpeI

Primer pair 3

                               *
   Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3'
   Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3'
                               *
    GC content: 54.55%           Location: 32-64
    Melting temp: 80.6°C         Mismatched bases: 1
    Length: 33 bp                Mutation: Substitution
    5' flanking region: 16 bp    Forward primer MW: 10187.73 Da
    3' flanking region: 16 bp    Reverse primer MW: 10080.66 Da