IGEM:MIT/2008/Notebook/Yogurt/2008/06/16

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
{|{{table}} width="800"
+
{|{{table}} width="900"
|-
|-
|style="background-color: #EEE"|[[Image:igem-logo-150px.png|150px]]<span style="font-size:22px;"> iGEM Project name 1</span>
|style="background-color: #EEE"|[[Image:igem-logo-150px.png|150px]]<span style="font-size:22px;"> iGEM Project name 1</span>

Revision as of 14:47, 16 June 2008

iGEM Project name 1 Main project page
Next entry

Entry title

  • sequence of prtB signal in L. Bulgaricus

3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'

    • amino acid sequence

M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T



Personal tools