IGEM:MIT/2008/Notebook/Yogurt/2008/06/16

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 7: Line 7:
==Entry title==
==Entry title==
* sequence of prtB signal in L. Bulgaricus
* sequence of prtB signal in L. Bulgaricus
-
3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'
+
3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'
** amino acid sequence
** amino acid sequence
M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T
M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T

Revision as of 14:48, 16 June 2008

iGEM Project name 1 Main project page
Next entry

Entry title

  • sequence of prtB signal in L. Bulgaricus

3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'

    • amino acid sequence

M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T



Personal tools