IGEM:MIT/2008/Notebook/Yogurt/2008/06/16

From OpenWetWare

< IGEM:MIT | 2008 | Notebook | Yogurt | 2008 | 06(Difference between revisions)
Jump to: navigation, search
Current revision (13:57, 16 June 2008) (view source)
 
Line 8: Line 8:
* sequence of prtB signal in L. Bulgaricus
* sequence of prtB signal in L. Bulgaricus
3'  TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA  5'
3'  TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA  5'
-
** amino acid sequence
+
amino acid sequence
-
M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T
+
M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T  
 +
 
 +
* amino acid sequence of p1025
 +
Q L K T A D L P A G R D E T T S F V L V

Current revision

iGEM Project name 1 Main project page
Next entry

Entry title

  • sequence of prtB signal in L. Bulgaricus

3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5' amino acid sequence M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T

  • amino acid sequence of p1025

Q L K T A D L P A G R D E T T S F V L V



Personal tools