IGEM:MIT/2008/Notebook/Yogurt/Notes

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 65: Line 65:
**melting temp = 72 C
**melting temp = 72 C
**GC content % = 51.3
**GC content % = 51.3
 +
 +
===Forward Primer for Promoter===
 +
[[Image:forward_prom.jpg]]
 +
foward sequence: TAA TAC GAG TCA CTA TAG GGA ATT AAA GAG GAG AAA ATG TAC GTC TTC TTT TTT AGG CGT GCG GTA AAC TTG TTT CAC CGA CTT AAT CGG CGT CGT GAC GAG GAT AGT CGC TCA GGT GAC CGC CCT TGA AA
 +
**length = 131 bp
 +
**melting temp = 71.4 C
 +
**GC content % = 45.0

Revision as of 15:25, 16 June 2008

Contents

JUN 10

Image:System_diagram_pic.jpg

JUN 16

Summary of individual tasks to research:

  1. S. Mutans metabolism pathway-Asad
  2. L. bulgaricus metabolism pathway-Allin
  3. secretion (full or partial)-John
  4. other secretion systems (introduction of)-Sara
  5. T7 as a promoter (L. bulgaricus)-Prarthna
  6. L. bulgaricus transformation/protocols-Derek
  7. binding assay protocols-Andrew
  8. epitope sequence

Linear Sequence/Design

Ex-promoter-RBS-ATG-signal-epitope-p1025-linker (TEV cleavage site)-GFP-His-TAATAA-termination-SP (see top of page)

  • Base pairs: 35-10-3-90-30-60-45-700-15-6-8
  • potential eptiopes
    • FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)
    • C-myc (E Q K L I S E E D L)
    • HA (Y P Y D U P D Y A: #2)

DNA/Plasmid Editor

Peptide Sequence Manipulations

Primer Analyzer Tool (check temperature & GC content)

  1. primers should be 17-28 bases in length;
  2. base composition should be 50-60% (G+C);
  3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;
  4. Tms between 55-80oC are preferred;
  5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;
  6. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided;
  7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

Parts/Construction

  1. Construction
    1. GFP
    2. Synthetic peptide
    3. L. bulgaricus vector
  2. Assay
  3. L. bulgaricus
  4. S. Mutans

To Do/To Buy:

  • finalize DNA sequence
  • primer
  • synthesis
  • reagents

Reverse Primer for GFP

Image:reversegfp.jpg

  • reverse sequence: CTGCAGCGGCCGCTACTAGTATTATTAAGAGATGTGAGAGATGTGAGAGATGTGAGAGATGTGAGAGATGTGAGAGATGTGTTTGTATAGTTCATC

Forward Primer for GFP

forward sequence: GAA AAC CTG TAC TTC CAG GGT GGT GGT GGT TCT GGT GGT GGT TCT GGT GGT GGT TCT TAC GCA TTT CCT CTT CTT

    • includes TEV cut site, half of linker, and 20 bp of GFP
    • length = 76 bp
    • melting temp = 72 C
    • GC content % = 51.3

Forward Primer for Promoter

Image:forward_prom.jpg foward sequence: TAA TAC GAG TCA CTA TAG GGA ATT AAA GAG GAG AAA ATG TAC GTC TTC TTT TTT AGG CGT GCG GTA AAC TTG TTT CAC CGA CTT AAT CGG CGT CGT GAC GAG GAT AGT CGC TCA GGT GAC CGC CCT TGA AA

    • length = 131 bp
    • melting temp = 71.4 C
    • GC content % = 45.0
Personal tools