IGEM:MIT/2008/Notebook/Yogurt/Notes

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(JUN 17)
Line 53: Line 53:
*synthesis
*synthesis
*reagents
*reagents
-
 
-
===P1: Forward Primer for Promoter===
 
-
[[Image:p1.jpg]]
 
-
**foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
 
-
**length = 110 bp
 
-
**melting temp = 68.8 C
 
-
**GC content % = 37.3
 
-
 
-
===P2: Reverse Primer for Peptide===
 
-
**reverse sequence: GTT CTT CTC CTT TAC GCA TAG AAC CAC CAC CAG AAC CAC C
 
-
**length = 69 bp
 
-
**melting temp = 71.8 C
 
-
**GC content % = 50.7
 
===TEV Protease cut site===
===TEV Protease cut site===
Line 72: Line 59:
* Base Pair Sequence: GAAAACCTGTACTTCCAGGGT
* Base Pair Sequence: GAAAACCTGTACTTCCAGGGT
-
===P3: Forward Primer for GFP===
 
-
forward sequence: GGT GGT TCT GGT GGT GGT TCT  ATG CGT AAA GGA GAA GAA C
 
-
 
-
**includes 21 bp of 2nd half of linker, and 19 bp of GFP
 
-
**length = 40 bp
 
-
**melting temp = 66.2 C
 
-
**GC content % = 50%
 
-
===P4: Reverse Primer for GFP===
 
-
[[image:P4-3.jpg]]
 
-
**reverse sequence: CTG CAG CGG CCG CTA CTA GTA TTA TTA GTG GTG ATG GTG ATG ATG TTT GTA TAG TTC ATC CAT GC
 
-
**length = 65 bp
 
-
**melting temp = 68.5 C
 
-
**GC content % = 44.6
 
==JUN 17==
==JUN 17==

Revision as of 10:29, 18 June 2008

Contents

JUN 10

Image:System_diagram_pic.jpg

JUN 16

Summary of individual tasks to research:

  1. S. Mutans metabolism pathway-Asad
  2. L. bulgaricus metabolism pathway-Allin
  3. secretion (full or partial)-John
  4. other secretion systems (introduction of)-Sara
  5. T7 as a promoter (L. bulgaricus)-Prarthna
  6. L. bulgaricus transformation/protocols-Derek
  7. binding assay protocols-Andrew

Linear Sequence/Design

Ex-promoter-RBS-ATG-signal-epitope-p1025-linker (TEV cleavage site)-GFP-His-TAATAA-termination-SP (see top of page)

  • Base pairs: 35-10-3-90-30-60-45-700-15-6-8
  • potential eptiopes
    • FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)
    • C-myc (E Q K L I S E E D L)
    • HA (Y P Y D U P D Y A: #2)

DNA/Plasmid Editor

Peptide Sequence Manipulations

Primer Analyzer Tool (check temperature & GC content)

  1. primers should be 17-28 bases in length;
  2. base composition should be 50-60% (G+C);
  3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;
  4. Tms between 55-80oC are preferred;
  5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;
  6. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided;
  7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

Parts/Construction

  1. Construction
    1. GFP
    2. Synthetic peptide
    3. L. bulgaricus vector
  2. Assay
  3. L. bulgaricus
  4. S. Mutans

To Do/To Buy:

  • finalize DNA sequence
  • primer
  • synthesis
  • reagents

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT


JUN 17

Links to sites from individual research topics

P4 Revised

image:P4-4.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA AGA GAA TAT AAA AAG CCA GAT TAT TAA TCC GGC TTT TTT ATT ATT TTT ATT AGT GGT GAT GGT GAT GAT GTT TGT ATA GTT CAT CCA TGC
    • length = 111 bp
    • melting temp = 69.6 C
    • GC content % = 36.0
Personal tools