IGEM:MIT/2008/Notebook/Yogurt/Notes

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 81: Line 81:
* [[../toothbindingassay | Tooth binding assay protocol]]
* [[../toothbindingassay | Tooth binding assay protocol]]
 +
 +
*http://www.freewebs.com/naguiar/ (S. mutans Information)
 +
===Friday Meeting breakdown===
===Friday Meeting breakdown===
#Andrew: primers
#Andrew: primers

Revision as of 15:47, 18 June 2008

Contents

JUN 10

Image:System_diagram_pic.jpg

JUN 16

Summary of individual tasks to research:

  1. S. Mutans metabolism pathway-Asad
  2. L. bulgaricus metabolism pathway-Allin
  3. secretion (full or partial)-John
  4. other secretion systems (introduction of)-Sara
  5. T7 as a promoter (L. bulgaricus)-Prarthna
  6. L. bulgaricus transformation/protocols-Derek
  7. binding assay protocols-Andrew

Linear Sequence/Design

Ex-promoter-RBS-ATG-signal-epitope-p1025-linker (TEV cleavage site)-GFP-His-TAATAA-termination-SP (see top of page)

  • Base pairs: 35-10-3-90-30-60-45-700-15-6-8
  • potential eptiopes
    • FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)
    • C-myc (E Q K L I S E E D L)
    • HA (Y P Y D U P D Y A: #2)

DNA/Plasmid Editor

Peptide Sequence Manipulations

Primer Analyzer Tool (check temperature & GC content)

  1. primers should be 17-28 bases in length;
  2. base composition should be 50-60% (G+C);
  3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;
  4. Tms between 55-80oC are preferred;
  5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;
  6. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided;
  7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

Parts/Construction

  1. Construction
    1. GFP
    2. Synthetic peptide
    3. L. bulgaricus vector
  2. Assay
  3. L. bulgaricus
  4. S. Mutans

To Do/To Buy:

  • finalize DNA sequence
  • primer
  • synthesis
  • reagents

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT


JUN 17

Links to sites from individual research topics

P4 Revised

image:P4-4.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA AGA GAA TAT AAA AAG CCA GAT TAT TAA TCC GGC TTT TTT ATT ATT TTT ATT AGT GGT GAT GGT GAT GAT GTT TGT ATA GTT CAT CCA TGC
    • length = 111 bp
    • melting temp = 69.6 C
    • GC content % = 36.0

JUN 18

Friday Meeting breakdown

  1. Andrew: primers
  2. Derek: L. bulgaricus procedures
  3. Allin: metabolism
  4. John: binding assay
  5. Sara: secretion
  6. Asad: S. Mutans/Binding Assay
  7. Prarthna: promoters
Personal tools