IGEM:MIT/2008/Notebook/Yogurt/sequences

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(sequence of signal - epitope - p1025 - epitope (in order))
(P2: Reverse Primer for Peptide)
Line 11: Line 11:
====P2: Reverse Primer for Peptide====
====P2: Reverse Primer for Peptide====
[[Image:reverse_pep.jpg]]
[[Image:reverse_pep.jpg]]
-
**reverse sequence: AAA AGT TCT TCT CCT TTA CGC ATA GAA CCA CCA CCA CCC TGG A
+
**reverse sequence: AAA AGT TCT TCT CCT TTA CGC ATA GAA CCA CCA CCA GAA CCA CCA CCA GAA CCA CCA CCA CCC TGG AAG
-
**length = 43 bp
+
**length = 69 bp
-
**melting temp = 67.3 C
+
**melting temp = 71.8 C
-
**GC content % = 46.5
+
**GC content % = 50.7
====TEV Protease cut site====
====TEV Protease cut site====

Revision as of 15:58, 16 June 2008

Contents

Primers

Include sequence, usage, temperatures, concentration, start date.

P1: Forward Primer for Promoter

Image:forward_prom.jpg

    • foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
    • length = 110 bp
    • melting temp = 68.8 C
    • GC content % = 37.3

P2: Reverse Primer for Peptide

Image:reverse_pep.jpg

    • reverse sequence: AAA AGT TCT TCT CCT TTA CGC ATA GAA CCA CCA CCA GAA CCA CCA CCA GAA CCA CCA CCA CCC TGG AAG
    • length = 69 bp
    • melting temp = 71.8 C
    • GC content % = 50.7

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT

P3: Forward Primer for GFP

forward sequence: GAA AAC CTG TAC TTC CAG GGT GGT GGT GGT TCT GGT GGT GGT TCT GGT GGT GGT TCT TAC GCA TTT CCT CTT CTT

    • includes TEV cut site, half of linker, and 20 bp of GFP
    • length = 76 bp
    • melting temp = 72 C
    • GC content % = 51.3

P4: Reverse Primer for GFP

Image:reversegfp.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA TTA TTA AGA GAT GTG AGA GAT GTG AGA GAT GTG AGA GAT GTG AGA GAT GTG AGA GAT GTG TTT GTA TAG TTC ATC
    • length = 96 bp
    • melting temp = 69.3 C
    • GC content % = 42.7

Plasmids

Include sequence, BioBrick #, functional features, digestion map.


PCR Products

Include sequence, template and primers, functional features.

Other

Sequence of signal - epitope - p1025 - epitope to synthesize 6/16/08

  • Possible changes:
    • longer linker sequences

Image:p1025-epitope.jpg

Personal tools