IGEM:MIT/2008/Notebook/Yogurt/sequences

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(P3: Forward Primer for GFP)
(P1: Forward Primer for Promoter)
Line 3: Line 3:
====P1: Forward Primer for Promoter====
====P1: Forward Primer for Promoter====
-
[[Image:forward_prom.jpg]]
+
[[Image:p1.jpg]]
**foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
**foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
**length = 110 bp
**length = 110 bp

Revision as of 16:25, 16 June 2008

Contents

Primers

Include sequence, usage, temperatures, concentration, start date.

P1: Forward Primer for Promoter

Image:p1.jpg

    • foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
    • length = 110 bp
    • melting temp = 68.8 C
    • GC content % = 37.3

P2: Reverse Primer for Peptide

Image:reverse_pep.jpg

    • reverse sequence: AAA AGT TCT TCT CCT TTA CGC ATA GAA CCA CCA CCA GAA CCA CCA CCA GAA CCA CCA CCA CCC TGG AAG
    • length = 69 bp
    • melting temp = 71.8 C
    • GC content % = 50.7

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT

P3: Forward Primer for GFP

forward sequence: GGT GGT TCT GGT GGT GGT TCT ATG CGT AAA GGA GAA GAA C

    • includes 21 bp of 2nd half of linker, and 19 bp of GFP
    • length = 40 bp
    • melting temp = 66.2 C
    • GC content % = 50%

P4: Reverse Primer for GFP

Image:reversegfp.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA TTA TTA CTC TAG AAG CGG CCG CGA ATT CTT TGT ATA GTT CAT CCA TGC
    • length = 69 bp
    • melting temp = 69.9 C
    • GC content % = 47.8

Plasmids

Include sequence, BioBrick #, functional features, digestion map.


PCR Products

Include sequence, template and primers, functional features.

Other

Sequence of signal - epitope - p1025 - epitope to synthesize 6/16/08


Image:p1025-epitope.jpg

Personal tools