IGEM:MIT/2008/Notebook/Yogurt/sequences

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 88: Line 88:
TATACAAACATCATCACCATCACCACTAATAAAAATAATAAAAAAGCCGG
TATACAAACATCATCACCATCACCACTAATAAAAATAATAAAAAAGCCGG
ATTAATAATCTGGCTTTTTATATTCTCTTACTAGTAGCGGCCGCTGCAG
ATTAATAATCTGGCTTTTTATATTCTCTTACTAGTAGCGGCCGCTGCAG
 +
 +
 +
[[Image:whole.pdf]]

Revision as of 15:11, 17 June 2008

Contents

Primers

Include sequence, usage, temperatures, concentration, start date.

P1: Forward Primer for Promoter

Image:p1.jpg

    • foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA CAG ATT AAA GAG GAG AAA TAC TAG ATG TAC GTC TTC TTT TTT AGG CG
    • length = 110 bp
    • melting temp = 68.8 C
    • GC content % = 37.3

P2: Reverse Primer for Peptide

    • reverse sequence: GTT CTT CTC CTT TAC GCA TAG AAC CAC CAC CAG AAC CAC C
    • length = 69 bp
    • melting temp = 71.8 C
    • GC content % = 50.7

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT

P3: Forward Primer for GFP

forward sequence: GGT GGT TCT GGT GGT GGT TCT ATG CGT AAA GGA GAA GAA C

    • includes 21 bp of 2nd half of linker, and 19 bp of GFP
    • length = 40 bp
    • melting temp = 66.2 C
    • GC content % = 50%

P4: Reverse Primer for GFP

image:P4-4.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA AGA GAA TAT AAA AAG CCA GAT TAT TAA TCC GGC TTT TTT ATT ATT TTT ATT AGT GGT GAT GGT GAT GAT GTT TGT ATA GTT CAT CCA TGC
    • length = 111 bp
    • melting temp = 69.6 C
    • GC content % = 36.0

Plasmids

Include sequence, BioBrick #, functional features, digestion map.


PCR Products

Include sequence, template and primers, functional features.

Other

DNA sequence to synthesize - epitope/p1025/linker (6/17/08)

  • 6/17, updated signal peptide, silent mutations in 1st part of linker (GGC instead of GGT coding for Gly)

Image:p1025-epitope.jpg

sequence: ATGATGCAGAAGAAAAAATCCGCACGCCATTTGAACAAAGTGGCTGAA TTAGCCGCAGCACTGCTCCTATCAGCGAGTCCACTGGCGGGAACTTTC GACTACAAAGACGACGACGACAAAGGTGGTGGTCAGCTGAAAACCGCT GACCTGCCGGCTGGTCGTGACGAAACCACCTCTTTCGTTCTGGTTGGT GGTGGTTACCCGTACGACGTTCCGGACTACGCTGGCGGCGGCTCTGGC GGCGGCTCTGGCGGCGGCTCTGAAAACCTGTACTTCCAGGGTGGTGGT GGTTCTGGTGGTGGTTCTGGTGGTGGTTCT

Whole Sequence

CCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAGCTACTTGTTC TTTTTGCATACTACAGATTAAAGAGGAGAAATACTAGATGATGCAGAAGA AAAAATCCGCACGCCATTTGAACAAAGTGGCTGAATTAGCCGCAGCACTG CTCCTATCAGCGAGTCCACTGGCGGGAACTTTCCAGTCAGCCGCTTTTGT CCAAGCTGCCAGTCAAGAAACGGACTACAAAGACGACGACGACAAAGGTG GTGGTCAGCTGAAAACCGCTGACCTGCCGGCTGGTCGTGACGAAACCACC TCTTTCGTTCTGGTTGGTGGTGGTTACCCGTACGACGTTCCGGACTACGC TGGTGGTGGTTCTGGTGGTGGTTCTGGTGGTGGTTCTGAAAACCTGTACT TCCAGGGTGGTGGTGGTTCTGGTGGTGGTTCTGGTGGTGGTTCTATGCGT AAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGA TGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTG ATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAA CTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCA ATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGA GTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGAT GACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCT TGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACA TTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATC ATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACA CAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATA CTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCC ACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGT CCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAAC TATACAAACATCATCACCATCACCACTAATAAAAATAATAAAAAAGCCGG ATTAATAATCTGGCTTTTTATATTCTCTTACTAGTAGCGGCCGCTGCAG


Image:whole.pdf

Personal tools