IGEM:MIT/2008/Notebook/Yogurt/sequences

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Whole Sequence)
(Primers)
Line 3: Line 3:
====P1: Forward Primer for Promoter====
====P1: Forward Primer for Promoter====
-
[[Image:p1.jpg]]
+
[[Image:P1-2.jpg]]
-
**foward sequence: CCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCATACTAGAGATTAAAGAGGAGAAATACTAGATGCAGAAGAAAAAATCCGC
+
**foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA GAG ATT AAA GAG GAG AAA TAC TAG ATG CAG AAG AAA AAA TCC GC
-
**length = 110 bp
+
**length = 107 bp
-
**melting temp = 68.8 C
+
**melting temp = 68.9 C
-
**GC content % = 37.3
+
**GC content % = 37.4
====P2: Reverse Primer for Peptide====
====P2: Reverse Primer for Peptide====
-
**reverse sequence: GTTCTTCTCCTTTACGCATgctGCCCCCGCCgctGCCGCC
+
[[Image:P2.jpg]]
-
**length = 69 bp
+
**reverse sequence: GTT CTT CTC CTT TAC GCA TGC TGC CCC CGC CGC TGC CGC C
-
**melting temp = 71.8 C
+
**length = 40 bp
-
**GC content % = 50.7
+
**melting temp = 74.7 C
 +
**GC content % = 67.5
====TEV Protease cut site====
====TEV Protease cut site====
Line 21: Line 22:
===P3: Forward Primer for GFP===
===P3: Forward Primer for GFP===
-
**forward sequence: GGCGGCagcGGCGGGGGCagcATGCGTAAAGGAGAAGAAC
+
[[Image:P3.jpg]]
-
 
+
**forward sequence: GGC GGC AGC GGC GGG GGC AGC ATG CGT AAA GGA GAA GAA C
-
**includes 21 bp of 2nd half of linker, and 19 bp of GFP
+
**length = 40 bp
**length = 40 bp
-
**melting temp = 66.2 C
+
**melting temp = 74.7 C
-
**GC content % = 50%
+
**GC content % = 67.5
===P4: Reverse Primer for GFP===
===P4: Reverse Primer for GFP===

Revision as of 10:42, 18 June 2008

Contents

Primers

Include sequence, usage, temperatures, concentration, start date.

P1: Forward Primer for Promoter

Image:P1-2.jpg

    • foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA GAG ATT AAA GAG GAG AAA TAC TAG ATG CAG AAG AAA AAA TCC GC
    • length = 107 bp
    • melting temp = 68.9 C
    • GC content % = 37.4

P2: Reverse Primer for Peptide

Image:P2.jpg

    • reverse sequence: GTT CTT CTC CTT TAC GCA TGC TGC CCC CGC CGC TGC CGC C
    • length = 40 bp
    • melting temp = 74.7 C
    • GC content % = 67.5

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT

P3: Forward Primer for GFP

Image:P3.jpg

    • forward sequence: GGC GGC AGC GGC GGG GGC AGC ATG CGT AAA GGA GAA GAA C
    • length = 40 bp
    • melting temp = 74.7 C
    • GC content % = 67.5

P4: Reverse Primer for GFP

image:P4-4.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA AGA GAA TAT AAA AAG CCA GAT TAT TAA TCC GGC TTT TTT ATT ATT TTT ATT AGT GGT GAT GGT GAT GAT GTT TGT ATA GTT CAT CCA TGC
    • length = 111 bp
    • melting temp = 69.6 C
    • GC content % = 36.0

P5: Reverse Primer for GFP without Terminator

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA TTA TTA GTG GTG ATG GTG ATG ATG TTT GTA TAG TTC ATC CAT GC
    • length = 65bp
    • GC content = 44.6 %
    • melting temp = 68.5 ºC

Plasmids

Include sequence, BioBrick #, functional features, digestion map.


PCR Products

Include sequence, template and primers, functional features.

Other

DNA sequence to synthesize - epitope/p1025/linker (6/17/08)

  • 6/17, updated signal peptide, silent mutations in 1st part of linker (GGC instead of GGT coding for Gly)

Image:p1025-epitope.jpg

sequence: ATGCAGAAGAAAAAATCCGCACGCCATTTGAACAAAGTGGCTGAA TTAGCCGCAGCACTGCTCCTATCAGCGAGTCCACTGGCGGGAACTTTC GACTACAAAGACGACGACGACAAAGGTGGTGGTCAGCTGAAAACCGCT GACCTGCCGGCTGGTCGTGACGAAACCACCTCTTTCGTTCTGGTTGGT GGTGGTTACCCGTACGACGTTCCGGACTACGCTGGCGGCGGCTCTGGC GGCGGCTCTGGCGGCGGCTCTGAAAACCTGTACTTCCAGGGTGGTGGT GGTTCTGGTGGTGGTTCTGGTGGTGGTTCT

Whole Sequence

CCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAG CTACTTGTTCTTTTTGCATACTAGAGATTAAAGAGGAGAA ATACTAGATGCAGAAGAAAAAATCCGCACGCCATTTGAAC AAAGTGGCTGAATTAGCCGCAGCACTGCTCCTATCAGCGA GTCCACTGGCGGGAACTTTCCAGTCAGCCGCTTTTGTCCA AGCTGCCAGTCAAGAAACGGACTACAAAGACGACGACGAC AAAGGTGGTGGTCAGCTGAAAACCGCTGACCTGCCGGCTG GTCGTGACGAAACCACCTCTTTCGTTCTGGTTGGTGGTGG TTACCCGTACGACGTTCCGGACTACGCTGGtGGtGGtTCT GGtGGtGGtTCTGGtGGtGGtTCTGAAAACCTGTACTTCC AGGGTGGTGGTGGTTCTGGTGGcGGCagcGGcGGgGGCag cATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCA ATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAAT TTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGG AAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTA CCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATG GTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACA GCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTA CAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACA AGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGT TAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGAT GGAAACATTCTTGGACACAAATTGGAATACAACTATAACT CACACAATGTATACATCATGGCAGACAAACAAAAGAATGG AATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGAT GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTC CAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTA CCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAA AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTG CTGGGATTACACATGGCATGGATGAACTATACAAACATCA TCACCATCACCACTAATAAAAATAATAAAAAAGCCGGATT AATAATCTGGCTTTTTATATTCTCTTACTAGTAGCGGCCG CTGCAGGATTA


Image:whole.pdf

Personal tools