IGEM:MIT/2008/Notebook/Yogurt/sequences

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(DNA sequence to synthesize - epitope/p1025/linker (6/17/08))
Line 53: Line 53:
**GC content = 44.6 %
**GC content = 44.6 %
**melting temp = 68.5 ºC
**melting temp = 68.5 ºC
-
**'''concentration:'''
+
**original concentration:
-
***original:
+
 
-
***dilute:
+
 
 +
===P6: Forward Primer for BioBrick  FLAG tag
 +
 
 +
**sequence: GAATTCGCGGCCGCTTCTAGAGACTACAAAGACGACGACGACAAAACTAGTAGCGGCCGCTGCAG
 +
**length = 65bp
 +
**GC content =  55.4%
 +
**melting temp = 72.1 ºC
 +
**concentration:
 +
 
 +
 
 +
 
==Plasmids==
==Plasmids==

Revision as of 11:17, 25 June 2008

Contents

Primers

Include sequence, usage, temperatures, concentration, start date.

P1: Forward Primer for Promoter

Image:P1-2.jpg

    • foward sequence: CCG CTT CTA GAG TAA TAC GAC TCA CTA TAG GGA ATA CAA GCT ACT TGT TCT TTT TGC ATA CTA GAG ATT AAA GAG GAG AAA TAC TAG ATG CAG AAG AAA AAA TCC GC
    • length = 107 bp
    • GC content = 37.4 %
    • melting temp = 68.9 ºC
    • concentration:
      • original:
      • dilute:

P2: Reverse Primer for Peptide

Image:P2.jpg

    • reverse sequence: GTT CTT CTC CTT TAC GCA TGC TGC CCC CGC CGC TGC CGC C
    • length = 40 bp
    • GC content = 67.5 %
    • melting temp = 74.7 ºC
    • concentration:
      • original:
      • dilute:

TEV Protease cut site

  • Amino Acid Sequence : Glu-Asn-Leu-Tyr-Phe-Gln-Gly (Cuts between Gln-Gly)
  • Base Pair Sequence: GAAAACCTGTACTTCCAGGGT

P3: Forward Primer for GFP

Image:P3.jpg

    • forward sequence: GGC GGC AGC GGC GGG GGC AGC ATG CGT AAA GGA GAA GAA C
    • length = 40 bp
    • GC content = 67.5 %
    • melting temp = 74.7 ºC
    • concentration:
      • original:
      • dilute: 5μM?

P4: Reverse Primer for GFP

Image:P4-5.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA AGA GAA TAT AAA AAG CCA GAT TAT TAA TCC GGC TTT TTT ATT ATT TTT ATT AGT GGT GAT GGT GAT GAT GTT TGT ATA GTT CAT CCA TGC
    • length = 111 bp
    • GC content % = 36.0 %
    • melting temp = 69.6 ºC
    • concentration:
      • original:
      • dilute: 5μM?

P5: Reverse Primer for GFP without Terminator

Image:P5.jpg

    • reverse sequence: CTG CAG CGG CCG CTA CTA GTA TTA TTA GTG GTG ATG GTG ATG ATG TTT GTA TAG TTC ATC CAT GC
    • length = 65bp
    • GC content = 44.6 %
    • melting temp = 68.5 ºC
    • original concentration:


===P6: Forward Primer for BioBrick FLAG tag

    • sequence: GAATTCGCGGCCGCTTCTAGAGACTACAAAGACGACGACGACAAAACTAGTAGCGGCCGCTGCAG
    • length = 65bp
    • GC content = 55.4%
    • melting temp = 72.1 ºC
    • concentration:



Plasmids

Include sequence, BioBrick #, functional features, digestion map.


PCR Products

Include sequence, template and primers, functional features.

Other

DNA sequence to synthesize - epitope/p1025/linker (6/17/08)

  • 6/17, lengthened signal peptide so that it will cleave properly
  • silent mutations in linkers to reduce repetition and to ensure specificity of primers (ex. GGC/GGA/GGG instead of GGT coding for Gly)

Image:p1025-epitope.png

sequence: ATGCAGAAGAAAAAATCCGCACGCCATTTGAACAAAGTGGCTGAATTAGCCGCAGCACTGCTCC TATCAGCGAGTCCACTGGCGGGAACTTTCCAGTCAGCCGCTTTTGTCCAAGCTGCCAGTCAAGA AACGgctccggttaccGACTACAAAGACGACGACGACAAAGGaGGTGGcCAGCTGAAAACCGCT GACCTGCCGGCTGGTCGTGACGAAACCACCTCTTTCGTTCTGGTTGGTGGaGGgTACCCGTACG ACGTTCCGGACTACGCTGGaGGtGGgTCTGGcGGtGGaTCaGGgGGtGGaTCgGAAAACCTGTA CTTCCAGGGTGGTGGaGGcTCcGGTGGcGGCagcGGcGGgGGCagc

Whole Sequence

CCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAG CTACTTGTTCTTTTTGCATACTAGAGATTAAAGAGGAGAA ATACTAGATGCAGAAGAAAAAATCCGCACGCCATTTGAAC AAAGTGGCTGAATTAGCCGCAGCACTGCTCCTATCAGCGA GTCCACTGGCGGGAACTTTCCAGTCAGCCGCTTTTGTCCA AGCTGCCAGTCAAGAAACGGCTCCGGTTACCGACTACAAA GACGACGACGACAAAGGaGGTGGcCAGCTGAAAACCGCTG ACCTGCCGGCTGGTCGTGACGAAACCACCTCTTTCGTTCT GGTTGGTGGaGGgTACCCGTACGACGTTCCGGACTACGCT GGaGGtGGgTCTGGcGGtGGaTCaGGgGGtGGaTCgGAAA ACCTGTACTTCCAGGGTGGTGGaGGcTCcGGTGGcGGCag cGGcGGgGGCagcATGCGTAAAGGAGAAGAACTTTTCACT GGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTA ATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGA TGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACT ACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTA CTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGA TCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCC GAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATG ACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGG TGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGAT TTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAAT ACAACTATAACTCACACAATGTATACATCATGGCAGACAA ACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACAC AACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATC AACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACC AGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAA GATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGT TTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACT ATACAAACATCATCACCATCACCACTAATAAAAATAATAA AAAAGCCGGATTAATAATCTGGCTTTTTATATTCTCTTAC TAGTAGCGGCCGCTGCAGGATTA

Image:wholesequence.png

Personal tools