
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Bbelmont (Talk | contribs)
(New page: pcyA - I15009 in the registry (750bp) atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtaga...)
Next diff →

Revision as of 13:20, 8 June 2009

pcyA - I15009 in the registry (750bp)


HY2 Sequence AT3G09150.2



Personal tools