
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: pcyA - I15009 in the registry (750bp) atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtaga...)
Line 6: Line 6:
HY2 Sequence AT3G09150.2
HY2 Sequence AT3G09150.2
Line 26: Line 27:

Revision as of 12:20, 8 June 2009

pcyA - I15009 in the registry (750bp)


HY2 Sequence AT3G09150.2


Personal tools