IGEM:MIT/2009/DNA/PCBsynthesis

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
HY2 Sequence AT3G09150.2
HY2 Sequence AT3G09150.2
-
<nowiki>
+
<code>
   1 ATGGCTTTAT CAATGGAGTT TGGGTTTTCA ATTGGGTCAT GCTTCAAGGC
   1 ATGGCTTTAT CAATGGAGTT TGGGTTTTCA ATTGGGTCAT GCTTCAAGGC
  51 ACCAAACCCA CCTGTTCTAA TCTCTGCAAG CCCTAATAAG ATCAATTTCA
  51 ACCAAACCCA CCTGTTCTAA TCTCTGCAAG CCCTAATAAG ATCAATTTCA
Line 28: Line 28:
951 AACTCGTCCA TGGGATTTAA CAGGACAATT TATCGGCTAA
951 AACTCGTCCA TGGGATTTAA CAGGACAATT TATCGGCTAA
-
</nowiki>
+
</code>

Revision as of 12:21, 8 June 2009

pcyA - I15009 in the registry (750bp)

atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataa


HY2 Sequence AT3G09150.2

 1 ATGGCTTTAT CAATGGAGTT TGGGTTTTCA ATTGGGTCAT GCTTCAAGGC
51 ACCAAACCCA CCTGTTCTAA TCTCTGCAAG CCCTAATAAG ATCAATTTCA

101 CGTTGAGAAG GAGAAAGAAA AGATTCTTAC TTAGAGTCTC TGCTGTGTCG 151 TATAAGGAAT TCGCAGAGTC TGCTTTAGAA GAAACCAGGA AAAGGATCGT 201 TCTTGAACCT TCACATCTCC AGGAAAAGTA TAGTAGCATG ACAGGACTAG 251 ATGGTAAGAC CGAACTTCAA ATGCTTGCTT TTAAATCTTC AAAGATTAGA 301 CTCTTGAGGA GTATGGCAAT AGAGAATGAG ACAATGCAGG TCTTTGACTT 351 TGCGGGTTTC ATGGAGCCTG AGTATGATAC TCCCATATTC TGTGCTAACT 401 TTTTCACATC TACCAACGTT AACATAGTTG TATTGGACCT TAATCCTTTG 451 CATCAGTTGA CTGACCAGAC GGATTACCAA GACAAGTATT ATAACAAGAT 501 AATGTCCATA TATCACAAAT ATGCTGAGAC TTTCCCATGG GGAGGGAAAT 551 TGACTGGTGA ATCCATAAAG TTTTTCTCGC CTTTGGTGAT GTGGACTAGG 601 TTTTCGTCTA GCAAAGAAAA ACATAAGGCT TTGTTCTCTG CGTTTCTAGA 651 GTACTATCAG GCATGGCTTG AGATGACAAT CCAAGTGAGG GAGGAGATGG 701 AACCATCTCA TGTGAGAGCC AATTGTGAAG CACAACACAA GTACCTGACA 751 TGGCGAGCAC AAAAGGATCC TGGACATGGT CTTCTTAAAA GATTAGTAGG 801 TGAAGCAAAG GCAAAGGAGC TGCTAAGGGA TTTCCTGTTC AATGGGGTGG 851 ATGAGTTAGG CACAAAAACA TTCATTGATT ACTTTCCAGA GTACCAAACA 901 GAAGATGGAA CTGTAAGCGA TAAACGAAGT ATCATTGGGA AGTCATATGA 951 AACTCGTCCA TGGGATTTAA CAGGACAATT TATCGGCTAA

Personal tools