IGEM:MIT/2009/DNA/PCBsynthesis

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
HY2 Sequence AT3G09150.2
HY2 Sequence AT3G09150.2
-
<code>
+
ATGGCTTTATCAATGGAGTTTGGGTTTTCAATTGGGTCATGCTTCAAGGCACCAAACCCACCTGTTCTAA
-
  1 ATGGCTTTAT CAATGGAGTT TGGGTTTTCA ATTGGGTCAT GCTTCAAGGC
+
TCTCTGCAAGCCCTAATAAGATCAATTTCACGTTGAGAAGGAGAAAGAAAAGATTCTTACTTAGAGTCTC
-
51 ACCAAACCCA CCTGTTCTAA TCTCTGCAAG CCCTAATAAG ATCAATTTCA
+
TGCTGTGTCGTATAAGGAATTCGCAGAGTCTGCTTTAGAAGAAACCAGGAAAAGGATCGTTCTTGAACCT
-
101 CGTTGAGAAG GAGAAAGAAA AGATTCTTAC TTAGAGTCTC TGCTGTGTCG
+
TCACATCTCCAGGAAAAGTATAGTAGCATGACAGGACTAGATGGTAAGACCGAACTTCAAATGCTTGCTT
-
151 TATAAGGAAT TCGCAGAGTC TGCTTTAGAA GAAACCAGGA AAAGGATCGT
+
TTAAATCTTCAAAGATTAGACTCTTGAGGAGTATGGCAATAGAGAATGAGACAATGCAGGTCTTTGACTT
-
201 TCTTGAACCT TCACATCTCC AGGAAAAGTA TAGTAGCATG ACAGGACTAG
+
TGCGGGTTTCATGGAGCCTGAGTATGATACTCCCATATTCTGTGCTAACTTTTTCACATCTACCAACGTT
-
251 ATGGTAAGAC CGAACTTCAA ATGCTTGCTT TTAAATCTTC AAAGATTAGA
+
AACATAGTTGTATTGGACCTTAATCCTTTGCATCAGTTGACTGACCAGACGGATTACCAAGACAAGTATT
-
301 CTCTTGAGGA GTATGGCAAT AGAGAATGAG ACAATGCAGG TCTTTGACTT
+
ATAACAAGATAATGTCCATATATCACAAATATGCTGAGACTTTCCCATGGGGAGGGAAATTGACTGGTGA
-
351 TGCGGGTTTC ATGGAGCCTG AGTATGATAC TCCCATATTC TGTGCTAACT
+
ATCCATAAAGTTTTTCTCGCCTTTGGTGATGTGGACTAGGTTTTCGTCTAGCAAAGAAAAACATAAGGCT
-
401 TTTTCACATC TACCAACGTT AACATAGTTG TATTGGACCT TAATCCTTTG
+
TTGTTCTCTGCGTTTCTAGAGTACTATCAGGCATGGCTTGAGATGACAATCCAAGTGAGGGAGGAGATGG
-
451 CATCAGTTGA CTGACCAGAC GGATTACCAA GACAAGTATT ATAACAAGAT
+
AACCATCTCATGTGAGAGCCAATTGTGAAGCACAACACAAGTACCTGACATGGCGAGCACAAAAGGATCC
-
501 AATGTCCATA TATCACAAAT ATGCTGAGAC TTTCCCATGG GGAGGGAAAT
+
TGGACATGGTCTTCTTAAAAGATTAGTAGGTGAAGCAAAGGCAAAGGAGCTGCTAAGGGATTTCCTGTTC
-
551 TGACTGGTGA ATCCATAAAG TTTTTCTCGC CTTTGGTGAT GTGGACTAGG
+
AATGGGGTGGATGAGTTAGGCACAAAAACATTCATTGATTACTTTCCAGAGTACCAAACAGAAGATGGAA
-
601 TTTTCGTCTA GCAAAGAAAA ACATAAGGCT TTGTTCTCTG CGTTTCTAGA
+
CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT
-
651 GTACTATCAG GCATGGCTTG AGATGACAAT CCAAGTGAGG GAGGAGATGG
+
TATCGGCTAA
-
701 AACCATCTCA TGTGAGAGCC AATTGTGAAG CACAACACAA GTACCTGACA
+
-
751 TGGCGAGCAC AAAAGGATCC TGGACATGGT CTTCTTAAAA GATTAGTAGG
+
-
801 TGAAGCAAAG GCAAAGGAGC TGCTAAGGGA TTTCCTGTTC AATGGGGTGG
+
-
851 ATGAGTTAGG CACAAAAACA TTCATTGATT ACTTTCCAGA GTACCAAACA
+
-
901 GAAGATGGAA CTGTAAGCGA TAAACGAAGT ATCATTGGGA AGTCATATGA
+
-
951 AACTCGTCCA TGGGATTTAA CAGGACAATT TATCGGCTAA
+
-
 
+
-
</code>
+

Revision as of 12:22, 8 June 2009

pcyA - I15009 in the registry (750bp)

atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataa


HY2 Sequence AT3G09150.2

ATGGCTTTATCAATGGAGTTTGGGTTTTCAATTGGGTCATGCTTCAAGGCACCAAACCCACCTGTTCTAA TCTCTGCAAGCCCTAATAAGATCAATTTCACGTTGAGAAGGAGAAAGAAAAGATTCTTACTTAGAGTCTC TGCTGTGTCGTATAAGGAATTCGCAGAGTCTGCTTTAGAAGAAACCAGGAAAAGGATCGTTCTTGAACCT TCACATCTCCAGGAAAAGTATAGTAGCATGACAGGACTAGATGGTAAGACCGAACTTCAAATGCTTGCTT TTAAATCTTCAAAGATTAGACTCTTGAGGAGTATGGCAATAGAGAATGAGACAATGCAGGTCTTTGACTT TGCGGGTTTCATGGAGCCTGAGTATGATACTCCCATATTCTGTGCTAACTTTTTCACATCTACCAACGTT AACATAGTTGTATTGGACCTTAATCCTTTGCATCAGTTGACTGACCAGACGGATTACCAAGACAAGTATT ATAACAAGATAATGTCCATATATCACAAATATGCTGAGACTTTCCCATGGGGAGGGAAATTGACTGGTGA ATCCATAAAGTTTTTCTCGCCTTTGGTGATGTGGACTAGGTTTTCGTCTAGCAAAGAAAAACATAAGGCT TTGTTCTCTGCGTTTCTAGAGTACTATCAGGCATGGCTTGAGATGACAATCCAAGTGAGGGAGGAGATGG AACCATCTCATGTGAGAGCCAATTGTGAAGCACAACACAAGTACCTGACATGGCGAGCACAAAAGGATCC TGGACATGGTCTTCTTAAAAGATTAGTAGGTGAAGCAAAGGCAAAGGAGCTGCTAAGGGATTTCCTGTTC AATGGGGTGGATGAGTTAGGCACAAAAACATTCATTGATTACTTTCCAGAGTACCAAACAGAAGATGGAA CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT TATCGGCTAA

Personal tools