IGEM:MIT/2009/DNA/PCBsynthesis

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
pcyA - I15009 in the registry (750bp)
pcyA - I15009 in the registry (750bp)
-
atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataa
+
ATGGCCGTCACTGATTTAAGTTTGACCAATTCTTCCCTGATGCCTACGTTGAACCCGATGATTCAACAGT
-
 
+
TGGCCCTGGCGATCGCCGCTAGTTGGCAAAGTTTACCCCTCAAGCCCTATCAATTGCCGGAGGATTTGGG
 +
CTACGTAGAAGGCCGCCTGGAAGGGGAAAAGTTAGTGATTGAAAATCGGTGCTACCAAACGCCCCAGTTT
 +
CGCAAAATGCATTTGGAGTTGGCCAAGGTGGGCAAAGGGTTGGATATTCTCCACTGTGTAATGTTTCCTG
 +
AGCCTTTATACGGTCTACCTTTGTTTGGCTGTGACATTGTGGCCGGCCCCGGTGGAGTAAGTGCGGCTAT
 +
TGCGGATCTATCCCCCACCCAAAGCGATCGCCAATTGCCCGCAGCGTACCAAAAATCATTGGCAGAGCTA
 +
GGCCAGCCAGAATTTGAGCAACAACGGGAATTGCCCCCCTGGGGAGAAATATTTTCTGAATATTGTTTAT
 +
TCATCCGTCCCAGCAATGTCACTGAAGAAGAAAGATTTGTACAAAGGGTAGTGGACTTTTTGCAAATTCA
 +
TTGTCACCAATCCATCGTTGCCGAACCCTTGTCTGAAGCTCAAACTTTGGAGCACCGTCAGGGGCAAATT
 +
CATTACTGCCAACAACAACAGAAAAATGATAAAACCCGTCGGGTACTGGAAAAAGCTTTTGGGGAAGCTT
 +
GGGCGGAACGGTATATGAGCCAAGTCTTATTTGATGTTATCCAATAATAA
HY2 Sequence AT3G09150.2
HY2 Sequence AT3G09150.2

Revision as of 12:23, 8 June 2009

pcyA - I15009 in the registry (750bp)

ATGGCCGTCACTGATTTAAGTTTGACCAATTCTTCCCTGATGCCTACGTTGAACCCGATGATTCAACAGT TGGCCCTGGCGATCGCCGCTAGTTGGCAAAGTTTACCCCTCAAGCCCTATCAATTGCCGGAGGATTTGGG CTACGTAGAAGGCCGCCTGGAAGGGGAAAAGTTAGTGATTGAAAATCGGTGCTACCAAACGCCCCAGTTT CGCAAAATGCATTTGGAGTTGGCCAAGGTGGGCAAAGGGTTGGATATTCTCCACTGTGTAATGTTTCCTG AGCCTTTATACGGTCTACCTTTGTTTGGCTGTGACATTGTGGCCGGCCCCGGTGGAGTAAGTGCGGCTAT TGCGGATCTATCCCCCACCCAAAGCGATCGCCAATTGCCCGCAGCGTACCAAAAATCATTGGCAGAGCTA GGCCAGCCAGAATTTGAGCAACAACGGGAATTGCCCCCCTGGGGAGAAATATTTTCTGAATATTGTTTAT TCATCCGTCCCAGCAATGTCACTGAAGAAGAAAGATTTGTACAAAGGGTAGTGGACTTTTTGCAAATTCA TTGTCACCAATCCATCGTTGCCGAACCCTTGTCTGAAGCTCAAACTTTGGAGCACCGTCAGGGGCAAATT CATTACTGCCAACAACAACAGAAAAATGATAAAACCCGTCGGGTACTGGAAAAAGCTTTTGGGGAAGCTT GGGCGGAACGGTATATGAGCCAAGTCTTATTTGATGTTATCCAATAATAA

HY2 Sequence AT3G09150.2

ATGGCTTTATCAATGGAGTTTGGGTTTTCAATTGGGTCATGCTTCAAGGCACCAAACCCACCTGTTCTAA TCTCTGCAAGCCCTAATAAGATCAATTTCACGTTGAGAAGGAGAAAGAAAAGATTCTTACTTAGAGTCTC TGCTGTGTCGTATAAGGAATTCGCAGAGTCTGCTTTAGAAGAAACCAGGAAAAGGATCGTTCTTGAACCT TCACATCTCCAGGAAAAGTATAGTAGCATGACAGGACTAGATGGTAAGACCGAACTTCAAATGCTTGCTT TTAAATCTTCAAAGATTAGACTCTTGAGGAGTATGGCAATAGAGAATGAGACAATGCAGGTCTTTGACTT TGCGGGTTTCATGGAGCCTGAGTATGATACTCCCATATTCTGTGCTAACTTTTTCACATCTACCAACGTT AACATAGTTGTATTGGACCTTAATCCTTTGCATCAGTTGACTGACCAGACGGATTACCAAGACAAGTATT ATAACAAGATAATGTCCATATATCACAAATATGCTGAGACTTTCCCATGGGGAGGGAAATTGACTGGTGA ATCCATAAAGTTTTTCTCGCCTTTGGTGATGTGGACTAGGTTTTCGTCTAGCAAAGAAAAACATAAGGCT TTGTTCTCTGCGTTTCTAGAGTACTATCAGGCATGGCTTGAGATGACAATCCAAGTGAGGGAGGAGATGG AACCATCTCATGTGAGAGCCAATTGTGAAGCACAACACAAGTACCTGACATGGCGAGCACAAAAGGATCC TGGACATGGTCTTCTTAAAAGATTAGTAGGTGAAGCAAAGGCAAAGGAGCTGCTAAGGGATTTCCTGTTC AATGGGGTGGATGAGTTAGGCACAAAAACATTCATTGATTACTTTCCAGAGTACCAAACAGAAGATGGAA CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT TATCGGCTAA

Personal tools