IGEM:MIT/2009/DNA/PCBsynthesis

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 30: Line 30:
CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT
CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT
TATCGGCTAA
TATCGGCTAA
 +
 +
===================================
 +
Oligos for XmaI-Kozak-ATG-MTS-SpeI
 +
===================================
 +
C CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A CTAGT
 +
GGGCC C TTGTTT TAC GTT GCG AGG TAA AAA CGC TCC AAG TGATC A
 +
 +
 +
 +
XmaI_mts1(+), CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A
 +
 +
 +
SpeI_mts1(-), CTAGT GAA CCT CGC AAA AAT GGA GCG TTG CAT TTTGTT C

Revision as of 13:23, 8 June 2009

pcyA - I15009 in the registry (750bp)

ATGGCCGTCACTGATTTAAGTTTGACCAATTCTTCCCTGATGCCTACGTTGAACCCGATGATTCAACAGT TGGCCCTGGCGATCGCCGCTAGTTGGCAAAGTTTACCCCTCAAGCCCTATCAATTGCCGGAGGATTTGGG CTACGTAGAAGGCCGCCTGGAAGGGGAAAAGTTAGTGATTGAAAATCGGTGCTACCAAACGCCCCAGTTT CGCAAAATGCATTTGGAGTTGGCCAAGGTGGGCAAAGGGTTGGATATTCTCCACTGTGTAATGTTTCCTG AGCCTTTATACGGTCTACCTTTGTTTGGCTGTGACATTGTGGCCGGCCCCGGTGGAGTAAGTGCGGCTAT TGCGGATCTATCCCCCACCCAAAGCGATCGCCAATTGCCCGCAGCGTACCAAAAATCATTGGCAGAGCTA GGCCAGCCAGAATTTGAGCAACAACGGGAATTGCCCCCCTGGGGAGAAATATTTTCTGAATATTGTTTAT TCATCCGTCCCAGCAATGTCACTGAAGAAGAAAGATTTGTACAAAGGGTAGTGGACTTTTTGCAAATTCA TTGTCACCAATCCATCGTTGCCGAACCCTTGTCTGAAGCTCAAACTTTGGAGCACCGTCAGGGGCAAATT CATTACTGCCAACAACAACAGAAAAATGATAAAACCCGTCGGGTACTGGAAAAAGCTTTTGGGGAAGCTT GGGCGGAACGGTATATGAGCCAAGTCTTATTTGATGTTATCCAATAATAA

HY2 Sequence AT3G09150.2

ATGGCTTTATCAATGGAGTTTGGGTTTTCAATTGGGTCATGCTTCAAGGCACCAAACCCACCTGTTCTAA TCTCTGCAAGCCCTAATAAGATCAATTTCACGTTGAGAAGGAGAAAGAAAAGATTCTTACTTAGAGTCTC TGCTGTGTCGTATAAGGAATTCGCAGAGTCTGCTTTAGAAGAAACCAGGAAAAGGATCGTTCTTGAACCT TCACATCTCCAGGAAAAGTATAGTAGCATGACAGGACTAGATGGTAAGACCGAACTTCAAATGCTTGCTT TTAAATCTTCAAAGATTAGACTCTTGAGGAGTATGGCAATAGAGAATGAGACAATGCAGGTCTTTGACTT TGCGGGTTTCATGGAGCCTGAGTATGATACTCCCATATTCTGTGCTAACTTTTTCACATCTACCAACGTT AACATAGTTGTATTGGACCTTAATCCTTTGCATCAGTTGACTGACCAGACGGATTACCAAGACAAGTATT ATAACAAGATAATGTCCATATATCACAAATATGCTGAGACTTTCCCATGGGGAGGGAAATTGACTGGTGA ATCCATAAAGTTTTTCTCGCCTTTGGTGATGTGGACTAGGTTTTCGTCTAGCAAAGAAAAACATAAGGCT TTGTTCTCTGCGTTTCTAGAGTACTATCAGGCATGGCTTGAGATGACAATCCAAGTGAGGGAGGAGATGG AACCATCTCATGTGAGAGCCAATTGTGAAGCACAACACAAGTACCTGACATGGCGAGCACAAAAGGATCC TGGACATGGTCTTCTTAAAAGATTAGTAGGTGAAGCAAAGGCAAAGGAGCTGCTAAGGGATTTCCTGTTC AATGGGGTGGATGAGTTAGGCACAAAAACATTCATTGATTACTTTCCAGAGTACCAAACAGAAGATGGAA CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT TATCGGCTAA

=======================

Oligos for XmaI-Kozak-ATG-MTS-SpeI

=======================

C CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A CTAGT GGGCC C TTGTTT TAC GTT GCG AGG TAA AAA CGC TCC AAG TGATC A


XmaI_mts1(+), CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A


SpeI_mts1(-), CTAGT GAA CCT CGC AAA AAT GGA GCG TTG CAT TTTGTT C

Personal tools