IGEM:MIT/2009/Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: {| class="wikitable" style="text-align:center; width:100%" border="1" |+Location of Materials |- ! Label!! Date !! Name !! Location!! Comment!!Sequence |- ! 1-pcyA-MTS-f | 5/8/2009 || DM ...)
Line 5: Line 5:
|-
|-
! 1-pcyA-MTS-f
! 1-pcyA-MTS-f
-
| 5/8/2009 || DM || ?? || GCG - Nde1 (RS) - MTS - PcyA || GCGCATATGCAACGCTCCATTTTTGCGAGGTTCGCCGTCACTGATTTAAGTTTGAC
+
| 6/8/2009 || DM || ?? || GCG - Nde1 (RS) - MTS - PcyA || GCGCATATGCAACGCTCCATTTTTGCGAGGTTCGCCGTCACTGATTTAAGTTTGAC
|-
|-
! 2-pcyA-f
! 2-pcyA-f
-
| 5/8/2009 || DM || ?? || GCG - Nde1 (RS) - PcyA || GCGCATATGGCCGTCACTGATTTAAGTTTGAC
+
| 6/8/2009 || DM || ?? || GCG - Nde1 (RS) - PcyA || GCGCATATGGCCGTCACTGATTTAAGTTTGAC
|-
|-
! 3-pcyA-b
! 3-pcyA-b
-
| 5/8/2009 || DM || ?? || GCG - Xba1 (RS) - PcyA || GCGTCTAGATTATTATTGGATAACATCAAATA
+
| 6/8/2009 || DM || ?? || GCG - Xba1 (RS) - PcyA || GCGTCTAGATTATTATTGGATAACATCAAATA
|}
|}

Revision as of 18:57, 8 June 2009

Location of Materials
Label Date Name Location CommentSequence
1-pcyA-MTS-f 6/8/2009 DM  ?? GCG - Nde1 (RS) - MTS - PcyA GCGCATATGCAACGCTCCATTTTTGCGAGGTTCGCCGTCACTGATTTAAGTTTGAC
2-pcyA-f 6/8/2009 DM  ?? GCG - Nde1 (RS) - PcyA GCGCATATGGCCGTCACTGATTTAAGTTTGAC
3-pcyA-b 6/8/2009 DM  ?? GCG - Xba1 (RS) - PcyA GCGTCTAGATTATTATTGGATAACATCAAATA
Personal tools