IGEM:Melbourne/2008/BioClock/Riboswitche

Return to Melbourne Homepage

Some basics of riboswitches:

- 5’ leader region of mRNA acts as switch.

- Can be used to modulate transcription, translation or mRNA processing

- by interaction with a specific cellular metabolite (artificial molecule or a piece of RNA)

- If the ligand is artificial, it is recognised in a preformed binding pocket, so that upon binding, it causes a conformational change.

RNA-based riboswitches acting at the level of translation

Components:

• crRNA (cis repressed RNA)--mRNA of interest containing inserted cr (cis repressive sequence). cr is just a nucleotide sequence placed on the 5’UTR (untranslated region) of the gene of interest such that it is downstream of the promoter for the gene but upstream of the RBS. Its sequence should show reverse complementarity to the RBS so that under normal circumstances, the RBS is not exposed and hence translation is repressed (since the ribosome can’t bind). In addition, the mRNA will need to contain a short nucleotide sequence between cr and RBS to actually form the loop. Below is just a crude pictorial representation of what crRNA would look like:

• taRNA (trans activating RNA)—-this is the “key” to unlock translation. It is a piece of RNA produced under another promoter. It will also contain an RBS so to prevent its translation (so that it remains as RNA), the RBS containing sequence is sequestered in the taRNA stem structure. The 5’ region of taRNA recognises a sequence on the loop of crRNA.

With the most efficient riboswitches, it is possible to get >96% repression.

Problems: There will be targeted degradation of double-stranded RNAs by RNases. So the amount of mRNA (crRNA) available for translation itself will be reduced (since, it will have a loop structure too). Isaacs et al. were able to introduce mismatches in taRNA to protect it from RNase III cleavage.

From Issacs et al, the crR12-taR12 pair produced the highest cis repression and greatest trans activation and it seems to have been very effective too.

The following are links to some online programs that should/might be useful to us when actually looking for riboswitches (these would be of particular interest to the engineers (?)):

1.http://frontend.bioinfo.rpi.edu/applications/mfold/ This was what Isaacs et al. used. It can be used to simulate the loop structures of RNA. Zuker, M (2003). Mfold web server for nucleic acid folding and hybridisation prediction. Nucleic Acids Research vol. 31 (No. 13).

2.http://riboswitch.bioapps.biozentrum.uni-wuerzburg.de/server.html You can enter your mRNA sequence (I think) into this and look for already existing riboswitches. Bengert, P & Dandekar, T (2004). Riboswitch finder—a tool for identification of riboswitch RNAs. Nucleic Acids Research 32 --explains how to use the above program (I'm not sure yet how helpful this is)

References: Same as what Stephen put up under general references (for now).

Some riboswitches from the Bioparts Registry

1) BBa_J01010 (Riboregulator lock 1) “Biobricked version of Isaacs' riboregulator cis repressed lock, crR12” aacuagaaucaccucuuggauuuggguauuaaagaggaga

BBa_J01060 OnLock1 = [pTet][Lock1 i.e. BBa_J01010] ucccuaucagugauagagauugacaucccuaucagugauagagauacugagcacuacuagagaacuagaaucaccucuuggauuuggguauuaaagaggaga

pTet: constitutively active promoter

BBa_J01008 (Riboregulator key 1) “BioBricked version of Isaacs' riboregulator trans-activating key, taR12” acccaaauccaggaggugaaucuaguaggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu

2) BBa_J01080 (lock3)

aacuagaaucaccucuugcuuuuggguaagaaagaggaga

BBa_J01122 [pTet][Lock3][RFP][DblTerm] ucccuaucagugauagagauugacaucccuaucagugauagagauacugagcacuacuagagaacuagaaucaccucuugcuuuuggguaagaaagaggagauacuagauggcuuccuccgaagacguuaucaaagaguucaugcguuucaaaguucguauggaagguuccguuaacggucacgaguucgaaaucgaaggugaaggugaaggucguccguacgaagguacccagaccgcuaaacugaaaguuaccaaaggugguccgcugccguucgcuugggacauccuguccccgcaguuccaguacgguuccaaagcuuacguuaaacacccggcugacaucccggacuaccugaaacuguccuucccggaagguuucaaaugggaacguguuaugaacuucgaagacggugguguuguuaccguuacccaggacuccucccugcaagacggugaguucaucuacaaaguuaaacugcgugguaccaacuucccguccgacgguccgguuaugcagaaaaaaaccauggguugggaagcuuccaccgaacguauguacccggaagacggugcucugaaaggugaaaucaaaaugcgucugaaacugaaagacgguggucacuacgacgcugaaguuaaaaccaccuacauggcuaaaaaaccgguucagcugccgggugcuuacaaaaccgacaucaaacuggacaucaccucccacaacgaagacuacaccaucguugaacaguacgaacgugcugaaggucgucacuccaccggugcuuaauaacgcugauagugcuaguguagaucgcuacuagagccaggcaucaaauaaaacgaaaggcucagucgaaagacugggccuuucguuuuaucuguuguuugucggugaacgcucucuacuagagucacacuggcucaccuucgggugggccuuucugcguuuaua

BBa_J01086 (key 3) acccaaaagcaggaggugaaucuaguaggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu

BBa_J23008 [key3c] (better than key 3) acccaaaagcaagaggugauucuaguuggugguuaaugaaaauuaacuuacuuacuagaaauaucucuaaaaagccagauuauuaauccggcuu

The region on J01086 that binds to the hairpin of J01080 anneals perfectly except for 3 base pairs which are mismatched. J23008 is exactly J01086 except these three base pairs have been corrected for perfect base pairing.

Please add/edit to your heart's content! (as I continue to do so myself) ;p