IGEM:Paris Bettencourt 2012/Notebooks/MAGE group/WikiRC

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Testing of the system)
(Overview)
Line 1: Line 1:
MAGE
MAGE
-
=Overview=
+
==Overview==
Multiplex automated genome engineering (MAGE) is a method for large-scale programming and evolution of cells.
Multiplex automated genome engineering (MAGE) is a method for large-scale programming and evolution of cells.
MAGE is a recently developed technique capable of editing the genome by making small changes in existing genomic sequences. This is accomplished by inserting single-stranded oligos that contain the desired mutations into the cell, and more than one gene can be targeted at a time simply by using multiple oligos. Mediated by λ-Red ssDNA-binding protein β, the oligos are incorporated into the lagging strand of the replication fork during DNA replication, creating a new allele that will spread through the population as the bacteria divide. The efficiency of oligo incorporation depends on several factors, but the frequency of the allele can be increased by performing multiple rounds of MAGE on the same cell culture. Currently, researchers must perform each round by hand, a procedure requiring several hours, but automated processes are being developed to run many rounds of MAGE in succession. Together, these properties make MAGE a highly useful tool for synthetic biology, allowing researchers to easily modify the bacterial genome and generate diversity within a population.
MAGE is a recently developed technique capable of editing the genome by making small changes in existing genomic sequences. This is accomplished by inserting single-stranded oligos that contain the desired mutations into the cell, and more than one gene can be targeted at a time simply by using multiple oligos. Mediated by λ-Red ssDNA-binding protein β, the oligos are incorporated into the lagging strand of the replication fork during DNA replication, creating a new allele that will spread through the population as the bacteria divide. The efficiency of oligo incorporation depends on several factors, but the frequency of the allele can be increased by performing multiple rounds of MAGE on the same cell culture. Currently, researchers must perform each round by hand, a procedure requiring several hours, but automated processes are being developed to run many rounds of MAGE in succession. Together, these properties make MAGE a highly useful tool for synthetic biology, allowing researchers to easily modify the bacterial genome and generate diversity within a population.
-
We will do it by hand  
+
We will do it by hand
=Objectives=
=Objectives=

Revision as of 12:28, 22 September 2012

MAGE

Contents

Overview

Multiplex automated genome engineering (MAGE) is a method for large-scale programming and evolution of cells. MAGE is a recently developed technique capable of editing the genome by making small changes in existing genomic sequences. This is accomplished by inserting single-stranded oligos that contain the desired mutations into the cell, and more than one gene can be targeted at a time simply by using multiple oligos. Mediated by λ-Red ssDNA-binding protein β, the oligos are incorporated into the lagging strand of the replication fork during DNA replication, creating a new allele that will spread through the population as the bacteria divide. The efficiency of oligo incorporation depends on several factors, but the frequency of the allele can be increased by performing multiple rounds of MAGE on the same cell culture. Currently, researchers must perform each round by hand, a procedure requiring several hours, but automated processes are being developed to run many rounds of MAGE in succession. Together, these properties make MAGE a highly useful tool for synthetic biology, allowing researchers to easily modify the bacterial genome and generate diversity within a population. We will do it by hand

Objectives

  • Test engineering of chromosomal DNA using single-stranded oligonucleotides.
  • Delete four restriction sites

Design

Image:MAGERS.png Present the design of your system, both in a written form, and a schematic one.

Experiments and results

Design of the MAGE oligo

The design of the MAGE oligo is critical to the success of the procedure. Typically 90 bases long, with the first four 5’ bases phosphorothioated, the oligo must match the sequence of the region of interest (with the exception of the desired mutations) such that it will be incorporated into the lagging strand during replication. To determine which genomic strand to use as the template, it is necessary to determine whether the gene is in replichore 1 or 2 and whether it is on the + or - strand. The mismatches, insertions, and/or deletions in the sequence must be centered on the oligo, and there should be as few alterations as possible, since each change will lower the efficiency of incorporation into the genome.

Results

lacZ Replicore 1 G 365'242 -> A stop codon

     *90mer oligo  generated by optMAGE
     GGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTAAGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAA

Testing of the system

Image:MAGELacZ.png

Unpurified Oligos

  • Efficiency 0,0002 = 0,02% (33623 Blue Colonies / 7 White Colonies)
  • no significant observation using different concentration of oligo
  • no significant observation using phosphothiolated or normal oligo

Purified Oligos=

  • Efficiency 0,0015 = 0,15% (4631 Blue Colonies / 7 White Colonies)

Results

Present your results

Personal tools