IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Claire Mayer (talk | contribs) No edit summary |
|||
Line 16: | Line 16: | ||
We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | ||
=Sequences= | |||
===Prefix 1=== | |||
Before sequences starting with ATG | |||
<code>GAATTCGCGGCCGCTTCTAG</code> | |||
===Prefix 2=== | |||
Before sequences starting with '''no''' ATG | |||
<code>GAATTCGCGGCCGCTTCTAGAG</code> | |||
===Suffix=== | |||
<code>TACTAGTAGCGGCCGCTGCAG</code> | |||
== Plasmid 1 : pSB3C5== | |||
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453] | |||
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032] | |||
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1] | |||
We used GBLOCKS to synthetize RBS_FseI |
Revision as of 08:41, 6 July 2012
Fse gene (gBlocks Gene Fragments)
- Gene sequence
- Check usage in E.Coli
- Check the lack of:
- EcoRI [E]
- Xbal [X]
- SpeI [S]
- PstI [P]
- FseI
- Codon optomozation
- ATG...TAA
- Salis Lab Calculator (not the strongest RBS)
We are planing FokI restriction site to devide sequence (almost in the middle).
Sequences
Prefix 1
Before sequences starting with ATG
GAATTCGCGGCCGCTTCTAG
Prefix 2
Before sequences starting with no ATG
GAATTCGCGGCCGCTTCTAGAG
Suffix
TACTAGTAGCGGCCGCTGCAG
Plasmid 1 : pSB3C5
- pbad : BBa_I13453
- RBS : BBa_B0032
- FseI: [1]
We used GBLOCKS to synthetize RBS_FseI