IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Claire Mayer (talk | contribs) No edit summary |
Claire Mayer (talk | contribs) No edit summary |
||
| Line 16: | Line 16: | ||
We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | ||
==RBS_FseI gBlocks construct== | |||
*Complete Construct: | |||
*Fragments 1: | |||
*Fragements 2: | |||
==RBS_IsceI gBlocks construct== | |||
*Complete Construct: | |||
*Fragments 1: | |||
*Fragements 2: | |||
=Sequences= | =Sequences= | ||
| Line 26: | Line 36: | ||
===Suffix=== | ===Suffix=== | ||
<code>TACTAGTAGCGGCCGCTGCAG</code> | <code>TACTAGTAGCGGCCGCTGCAG</code> | ||
== Plasmid 1 : pSB3C5_Pbad_RBS_FseI== | == Plasmid 1 : pSB3C5_Pbad_RBS_FseI== | ||
Revision as of 08:50, 6 July 2012
Fse gene (gBlocks Gene Fragments)
- Gene sequence
- Check usage in E.Coli
- Check the lack of:
- EcoRI [E]
- Xbal [X]
- SpeI [S]
- PstI [P]
- FseI
- Codon optomozation
- ATG...TAA
- Salis Lab Calculator (not the strongest RBS)
We are planing FokI restriction site to devide sequence (almost in the middle).
RBS_FseI gBlocks construct
- Complete Construct:
- Fragments 1:
- Fragements 2:
RBS_IsceI gBlocks construct
- Complete Construct:
- Fragments 1:
- Fragements 2:
Sequences
Prefix 1
Before sequences starting with ATG
GAATTCGCGGCCGCTTCTAG
Prefix 2
Before sequences starting with no ATG
GAATTCGCGGCCGCTTCTAGAG
Suffix
TACTAGTAGCGGCCGCTGCAG
Plasmid 1 : pSB3C5_Pbad_RBS_FseI
- pbad : BBa_I13453
- RBS : BBa_B0032
- FseI: [1]
We used GBLOCKS to synthetize RBS_FseI
Plasmid 2 : pSB3C5_Pbad_RBS_IsceI
- pbad : BBa_I13453
- RBS : BBa_B0032
- IsceI:
We used GBLOCKS to synthetize RBS_IsceI
Plasmid 3 : pSB3C5_Plac_RBS_FseI
We used GBLOCKS to synthetize RBS_FseI
Plasmid 4 : pSB3C5_Plac_RBS_IsceI
We used GBLOCKS to synthetize RBS_IsceI
