IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Claire Mayer (talk | contribs) |
Claire Mayer (talk | contribs) |
||
Line 19: | Line 19: | ||
==RBS_FseI gBlocks construct== | ==RBS_FseI gBlocks construct== | ||
===Complete Construct=== | ===Complete Construct=== | ||
[[Image:RBS_FseI.png|frame|thumb|center| | [[Image:RBS_FseI.png|frame|thumb|center|1060px|Figure 1 : RBS_FseI Complete Construct]] | ||
[[Media:RBS_FseI.geneious]] | [[Media:RBS_FseI.geneious]] |
Revision as of 07:10, 9 July 2012
Fse gene (gBlocks Gene Fragments)
- Gene sequence
- Check usage in E.Coli
- Check the lack of:
- EcoRI [E]
- Xbal [X]
- SpeI [S]
- PstI [P]
- FseI
- Codon optomozation
- ATG...TAA
- Salis Lab Calculator (not the strongest RBS)
We are planing FokI restriction site to devide sequence (almost in the middle).
RBS_FseI gBlocks construct
Complete Construct
Fragments 1
File:RBS FseI frag1.pdf Media:RBS_FseI_frg1.geneious
Fragements 2
RBS_IsceI gBlocks construct
Complete Construct
Fragments 1
Fragements 2
Sequences
Prefix 1
Before sequences starting with ATG
GAATTCGCGGCCGCTTCTAG
Prefix 2
Before sequences starting with no ATG
GAATTCGCGGCCGCTTCTAGAG
Suffix
TACTAGTAGCGGCCGCTGCAG
Plasmid 1 : pSB3C5_Pbad_RBS_FseI
- pbad : BBa_I13453
- RBS : BBa_B0032
- FseI: [1]
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)
Plasmid 2 : pSB3C5_Pbad_RBS_IsceI
- pbad : BBa_I13453
- RBS : BBa_B0032
- IsceI:
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)
Plasmid 3 : pSB3C5_Plac_RBS_FseI
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)
Plasmid 4 : pSB3C5_Plac_RBS_IsceI
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)