IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(44 intermediate revisions by 3 users not shown)
Line 4: Line 4:
#* Full: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450 Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]]
#* Full: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450 Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]]
#* Without methyltransferase: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450?from=1529&to=2188&report=gbwithparts Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]]
#* Without methyltransferase: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450?from=1529&to=2188&report=gbwithparts Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]]
# Check usage in '''E.Coli'''
# Check usage in ''E.Coli''
# Check the lack of:
# Check the lack of:
#* EcoRI '''(E)'''
#* ''EcoRI'' '''[E]'''
#* Xbal '''(X)'''
#* ''Xbal'' '''[X]'''
#* SpeI '''(S)'''
#* ''SpeI'' '''[S]'''
#* PstI '''(P)'''
#* ''PstI'' '''[P]'''
#* FseI
#* ''FseI''
# Codon optomozation: [https://bioinfo.invitrogen.com/geneartgenes/projectmgmt]
# [https://bioinfo.invitrogen.com/geneartgenes/projectmgmt Codon optomozation]
# ATG...TAA
# ATG...TAA
# Salis Lab Calculator (not the strongest RBS)
# [https://salis.psu.edu/ Salis Lab Calculator] (not the strongest RBS)


We are planing ''FokI'' restriction site to devide sequence (almost in the middle).
We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle).
 
==RBS_FseI gBlocks construct==
===Complete Construct===
[[Image:RBS_FseI.png|frameless|upright=4.5|Figure 1 : RBS_FseI Complete Construct]]
 
[[Media:RBS_FseI.geneious]]
 
===Fragments 1===
 
[[Image:RBS_FseI_frag1.png|frameless|upright=4.5|Figure 2 : RBS_FseI fragment 1]]
 
[[Media:RBS_FseI_frg1.geneious]]
===Fragements 2===
 
[[Image:RBS_FseI_frag2.png|frameless|upright=4.5|Figure 3 : RBS_FseI fragment 2]]
 
[[Media:RBS_FseI_frg2.geneious]]
 
==RBS_IsceI gBlocks construct==
===Complete Construct===
[[Image:RBS_ISceI.png|frameless|upright=4.5|Figure 4 : RBS_ISceI Complete Construct]]
 
[[Media:RBS_IsceI.geneious]]
===Fragments 1===
[[Image:RBS_ISceI_frag1.png|frameless|upright=4.5|Figure 5 : RBS_ISceI fragment 1]]
 
[[Media:RBS_IsceI_frg1.geneious]]
===Fragements 2===
[[Image:RBS_ISceI_frag2.png|frameless|upright=4.5|Figure 6 : RBS_ISceI fragment 2]]
 
[[Media:RBS_IsceI_frg2.geneious]]
 
=Sequences=
===Prefix 1===
Before sequences starting with ATG
<code>GAATTCGCGGCCGCTTCTAG</code>
===Prefix 2===
Before sequences starting with '''no''' ATG
<code>GAATTCGCGGCCGCTTCTAGAG</code>
===Suffix===
<code>TACTAGTAGCGGCCGCTGCAG</code>
 
 
== Plasmid 1 : pSB3C5_Pbad_RBS_FseI==
 
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1]
 
We used gBlocks to synthetize RBS_FseI
 
Geneious file : [[Media:Plasmid_Pbad_RBS_FseI.geneious]] (right click)
 
== Plasmid 2 : pSB3C5_Pbad_RBS_IsceI==
 
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*IsceI:
 
We used gBlocks to synthetize RBS_IsceI
 
Geneious file : [[Media:Plasmid_Pbad_RBS_IsceI.geneious]] (right click)
 
== Plasmid 3 : pSB3C5_Plac_RBS_FseI==
 
*Plac : [http://partsregistry.org/Part:BBa_R0011 BBa_R0011]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1]
 
We used gBlocks to synthetize RBS_FseI
 
Geneious file : [[Media:Plasmid_Plac_RBS_FseI.geneious]] (right click)
 
== Plasmid 4 : pSB3C5_Plac_RBS_IsceI==
 
*plac : [http://partsregistry.org/Part:BBa_R0011BBa_R0011]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*IsceI:
 
We used gBlocks to synthetize RBS_IsceI
 
Geneious file : [[Media:Plasmid_Plac_RBS_IsceI.geneious]] (right click)

Latest revision as of 07:39, 9 July 2012

Fse gene (gBlocks Gene Fragments)

  1. Gene sequence
  2. Check usage in E.Coli
  3. Check the lack of:
    • EcoRI [E]
    • Xbal [X]
    • SpeI [S]
    • PstI [P]
    • FseI
  4. Codon optomozation
  5. ATG...TAA
  6. Salis Lab Calculator (not the strongest RBS)

We are planing FokI restriction site to devide sequence (almost in the middle).

RBS_FseI gBlocks construct

Complete Construct

Figure 1 : RBS_FseI Complete Construct

Media:RBS_FseI.geneious

Fragments 1

Figure 2 : RBS_FseI fragment 1

Media:RBS_FseI_frg1.geneious

Fragements 2

Figure 3 : RBS_FseI fragment 2

Media:RBS_FseI_frg2.geneious

RBS_IsceI gBlocks construct

Complete Construct

Figure 4 : RBS_ISceI Complete Construct

Media:RBS_IsceI.geneious

Fragments 1

Figure 5 : RBS_ISceI fragment 1

Media:RBS_IsceI_frg1.geneious

Fragements 2

Figure 6 : RBS_ISceI fragment 2

Media:RBS_IsceI_frg2.geneious

Sequences

Prefix 1

Before sequences starting with ATG GAATTCGCGGCCGCTTCTAG

Prefix 2

Before sequences starting with no ATG GAATTCGCGGCCGCTTCTAGAG

Suffix

TACTAGTAGCGGCCGCTGCAG


Plasmid 1 : pSB3C5_Pbad_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)

Plasmid 2 : pSB3C5_Pbad_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)

Plasmid 3 : pSB3C5_Plac_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)

Plasmid 4 : pSB3C5_Plac_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)

Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Paris_Bettencourt_2012/Notebooks/RE_group/Construction_design&oldid=613118"