IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(39 intermediate revisions by 2 users not shown)
Line 16: Line 16:


We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle).
We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle).
==RBS_FseI gBlocks construct==
===Complete Construct===
[[Image:RBS_FseI.png|frameless|upright=4.5|Figure 1 : RBS_FseI Complete Construct]]
[[Media:RBS_FseI.geneious]]
===Fragments 1===
[[Image:RBS_FseI_frag1.png|frameless|upright=4.5|Figure 2 : RBS_FseI fragment 1]]
[[Media:RBS_FseI_frg1.geneious]]
===Fragements 2===
[[Image:RBS_FseI_frag2.png|frameless|upright=4.5|Figure 3 : RBS_FseI fragment 2]]
[[Media:RBS_FseI_frg2.geneious]]
==RBS_IsceI gBlocks construct==
===Complete Construct===
[[Image:RBS_ISceI.png|frameless|upright=4.5|Figure 4 : RBS_ISceI Complete Construct]]
[[Media:RBS_IsceI.geneious]]
===Fragments 1===
[[Image:RBS_ISceI_frag1.png|frameless|upright=4.5|Figure 5 : RBS_ISceI fragment 1]]
[[Media:RBS_IsceI_frg1.geneious]]
===Fragements 2===
[[Image:RBS_ISceI_frag2.png|frameless|upright=4.5|Figure 6 : RBS_ISceI fragment 2]]
[[Media:RBS_IsceI_frg2.geneious]]
=Sequences=
===Prefix 1===
Before sequences starting with ATG
<code>GAATTCGCGGCCGCTTCTAG</code>
===Prefix 2===
Before sequences starting with '''no''' ATG
<code>GAATTCGCGGCCGCTTCTAGAG</code>
===Suffix===
<code>TACTAGTAGCGGCCGCTGCAG</code>
== Plasmid 1 : pSB3C5_Pbad_RBS_FseI==
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1]
We used gBlocks to synthetize RBS_FseI
Geneious file : [[Media:Plasmid_Pbad_RBS_FseI.geneious]] (right click)
== Plasmid 2 : pSB3C5_Pbad_RBS_IsceI==
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*IsceI:
We used gBlocks to synthetize RBS_IsceI
Geneious file : [[Media:Plasmid_Pbad_RBS_IsceI.geneious]] (right click)
== Plasmid 3 : pSB3C5_Plac_RBS_FseI==
*Plac : [http://partsregistry.org/Part:BBa_R0011 BBa_R0011]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1]
We used gBlocks to synthetize RBS_FseI
Geneious file : [[Media:Plasmid_Plac_RBS_FseI.geneious]] (right click)
== Plasmid 4 : pSB3C5_Plac_RBS_IsceI==
*plac : [http://partsregistry.org/Part:BBa_R0011BBa_R0011]
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032]
*IsceI:
We used gBlocks to synthetize RBS_IsceI
Geneious file : [[Media:Plasmid_Plac_RBS_IsceI.geneious]] (right click)

Latest revision as of 07:39, 9 July 2012

Fse gene (gBlocks Gene Fragments)

  1. Gene sequence
  2. Check usage in E.Coli
  3. Check the lack of:
    • EcoRI [E]
    • Xbal [X]
    • SpeI [S]
    • PstI [P]
    • FseI
  4. Codon optomozation
  5. ATG...TAA
  6. Salis Lab Calculator (not the strongest RBS)

We are planing FokI restriction site to devide sequence (almost in the middle).

RBS_FseI gBlocks construct

Complete Construct

Figure 1 : RBS_FseI Complete Construct

Media:RBS_FseI.geneious

Fragments 1

Figure 2 : RBS_FseI fragment 1

Media:RBS_FseI_frg1.geneious

Fragements 2

Figure 3 : RBS_FseI fragment 2

Media:RBS_FseI_frg2.geneious

RBS_IsceI gBlocks construct

Complete Construct

Figure 4 : RBS_ISceI Complete Construct

Media:RBS_IsceI.geneious

Fragments 1

Figure 5 : RBS_ISceI fragment 1

Media:RBS_IsceI_frg1.geneious

Fragements 2

Figure 6 : RBS_ISceI fragment 2

Media:RBS_IsceI_frg2.geneious

Sequences

Prefix 1

Before sequences starting with ATG GAATTCGCGGCCGCTTCTAG

Prefix 2

Before sequences starting with no ATG GAATTCGCGGCCGCTTCTAGAG

Suffix

TACTAGTAGCGGCCGCTGCAG


Plasmid 1 : pSB3C5_Pbad_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)

Plasmid 2 : pSB3C5_Pbad_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)

Plasmid 3 : pSB3C5_Plac_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)

Plasmid 4 : pSB3C5_Plac_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)

Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Paris_Bettencourt_2012/Notebooks/RE_group/Construction_design&oldid=613118"