IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design

From OpenWetWare

< IGEM:Paris Bettencourt 2012 | Notebooks | RE group
Revision as of 10:39, 9 July 2012 by Claire Mayer (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

Fse gene (gBlocks Gene Fragments)

  1. Gene sequence
  2. Check usage in E.Coli
  3. Check the lack of:
    • EcoRI [E]
    • Xbal [X]
    • SpeI [S]
    • PstI [P]
    • FseI
  4. Codon optomozation
  5. ATG...TAA
  6. Salis Lab Calculator (not the strongest RBS)

We are planing FokI restriction site to devide sequence (almost in the middle).

RBS_FseI gBlocks construct

Complete Construct

Figure 1 : RBS_FseI Complete Construct

Media:RBS_FseI.geneious

Fragments 1

Figure 2 : RBS_FseI fragment 1

Media:RBS_FseI_frg1.geneious

Fragements 2

Figure 3 : RBS_FseI fragment 2

Media:RBS_FseI_frg2.geneious

RBS_IsceI gBlocks construct

Complete Construct

Figure 4 : RBS_ISceI Complete Construct

Media:RBS_IsceI.geneious

Fragments 1

Figure 5 : RBS_ISceI fragment 1

Media:RBS_IsceI_frg1.geneious

Fragements 2

Figure 6 : RBS_ISceI fragment 2

Media:RBS_IsceI_frg2.geneious

Sequences

Prefix 1

Before sequences starting with ATG GAATTCGCGGCCGCTTCTAG

Prefix 2

Before sequences starting with no ATG GAATTCGCGGCCGCTTCTAGAG

Suffix

TACTAGTAGCGGCCGCTGCAG


Plasmid 1 : pSB3C5_Pbad_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)

Plasmid 2 : pSB3C5_Pbad_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)

Plasmid 3 : pSB3C5_Plac_RBS_FseI

We used gBlocks to synthetize RBS_FseI

Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)

Plasmid 4 : pSB3C5_Plac_RBS_IsceI

We used gBlocks to synthetize RBS_IsceI

Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)

Personal tools