IGEM:Paris Bettencourt 2012/Notebooks/Semantic group/day by day//2012/08/13: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 13: | Line 13: | ||
QCM_1_Rev : GGACAATTACAAACAGGAATCTAATGTAACCGGCGC | QCM_1_Rev : GGACAATTACAAACAGGAATCTAATGTAACCGGCGC | ||
The | The protocol used for this is available [http://www.chem.agilent.com/Library/usermanuals/Public/200523.pdf '''here'''] | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Revision as of 06:19, 13 August 2012
 Project name
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
PCR QCMI ordered the following oligos in order to make the PCR QCM: QCM_1_Fw : GCGCCGGTTACATTAGATTCCTGTTTGTAATTGTCC QCM_1_Rev : GGACAATTACAAACAGGAATCTAATGTAACCGGCGC The protocol used for this is available here | |
