IGEM:Peking University/2008/Notebook/Group 2/2008/05/17: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2008/05/17 Entry for IGEM:Peking_University/2008/Notebook/Group_2) |
|||
| Line 5: | Line 5: | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
== | ==Primer design== | ||
* | :'''Primer 1''' | ||
:*Primer name: F-Gal4-HindIII-Apal | |||
:*Sequence(5'to3'):AAAAAGCTTGGGCCCTTTTAAGAGAGGACAGAGAAGCAAGCCTC | |||
:*Tm:64.1°C | |||
:'''Primer 2''' | |||
:*Primer name: R-Gal4-EcoRI-Xhol | |||
:*Sequence(5'to3'):GGGGAATTCCTCGAGTGCGGGGTTTTTCAGTATCTACGATTCATT | |||
:*Tm:64.0°C | |||
==PCR== | |||
{|border="1" cellspacing="0" | |||
|+ '''TITLE: PCR-Budding Yeast Genome-Gal4-K.O.D 50ul''' | |||
|- | |||
| ||Volume (μL) | |||
|- | |||
|Template （Budding Yeast Genome）||1 | |||
|- | |||
|dNTP||5 | |||
|- | |||
|Enzyme||1 | |||
|- | |||
|Buffer||5 | |||
|- | |||
|MgSO4(For KOD)||2 | |||
|- | |||
|F-Gal4-HindIII-ApaI ||1 | |||
|- | |||
|R-Gal4-EcoRI-Xhol||1 | |||
|- | |||
|ddH2O||34 | |||
|} | |||
::'''conditions''' | |||
{|border="1" cellspacing="0" | |||
|+ | |||
|- | |||
|Temperature(&&&)||Time Length(0:00:00) | |||
|- | |||
| 94°C||07:00 | |||
|- | |||
| 94°C||00:30||30 cycles | |||
|- | |||
| 59°C||00:30||30 cycles | |||
|- | |||
| 55°C||00:30||30 cycles | |||
|- | |||
| 72°C||03:00||30 cycles | |||
|- | |||
| 72°C||07:00 | |||
|- | |||
| 4°C||Hold | |||
|} | |||
Revision as of 12:13, 22 July 2008
 Group 2
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||
Primer design
PCR
| |||||||||||||||||||||||||||||||||||||||
