IGEM:PennState/Labbook/AudreyLeung: Difference between revisions

Revision as of 08:30, 13 June 2007

crp ORF [1]

Ggaattcgcggccgcttctagag ATGGTGCTTGGCAAACC Forward primer

TmC 60

ctgcagcggccgctactagta TTAACGAGTGCCGTAAAC Reverse Primer

TmC 57

xylR ORF [2]

Ggaattcgcggccgcttctagag CCATGTTTACTAAACGTCAC Forward primer
TmC 56

ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer
TmC 58

Revision as of 07:41, 13 June 2007 (view source) ALeung (talk \| contribs) (→‎Primers) ← Older edit		Revision as of 08:30, 13 June 2007 (view source) ALeung (talk \| contribs) No edit summary Newer edit →
Line 1:		Line 1:
	~~<h2>'''June 12, 2007'''</h2>~~
	== Primers ==		== Primers ==