IGEM:PennState/Labbook/AudreyLeung: Difference between revisions
Line 18: | Line 18: | ||
ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer | ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer | ||
TmC 58 | TmC 58 | ||
<h1>'''June 26, 2007'''</h1> | |||
Competent cell preparation | |||
http://www.chem.uga.edu/scottgrp/GrpProtocols/Competent_cell_preparation.htm | |||
There are two main methods for preparation of competent bacterial cells (14) for transformation, the calcium chloride and the electroporation method. For the calcium chloride method, a glycerol cell culture stock of the respective E. coli strain is thawed and added to 50 ml of liquid media. This culture then is preincubated at 37degC for 1 hour, transferred to an incubator-shaker, and is incubated further for 2-3 hours. The cells are pelleted by centrifugation, resuspended in calcium chloride solution, and incubated in an ice-water bath. After another centrifugation step, the resulting cell pellet again is resuspended in calcium chloride to yield the final competent cell suspension. Competent cells are stored at 4degC, for up to several days. | |||
Calcium Chloride Protocol | |||
1. Thaw a frozen glycerol stock of the appropriate strain of E. coli, add it to an Erlenmeyer flask containing 50 ml of pre-warmed 2xTY (1) media, and pre-incubate in a 37degC water bath for 1 hour with no shaking. Further incubate for 2-3 hours at 37degC with shaking at 250 rpm. | |||
2. Transfer 40 ml of the cells to a sterile 50 ml polypropylene centrifuge tube, and collect the cells by centrifugation at 3000 rpm for 8 minutes at 4deg C in a GPR centrifuge (Beckman) or 6000 rpm for 8 minutes at 4degC in an RC5-B centrifuge (DuPont) equipped with an SS-34 rotor. For M13-based transformation, save the remaining 10 ml of culture in an ice-water bath for later use. | |||
3. After centrifugation, decant the supernatant and resuspend the cell pellet in one-half volume (20 ml) of cold, sterile 50 mM calcium chloride, incubate in an ice-water bath for 20 minutes, and centrifuge as before. | |||
4. Decant the supernatant and gently resuspend the cell pellet in one-tenth volume (4 ml) of cold, sterile 50 mM calcium chloride to yield the final competent cell suspension. | |||
Preparation of calcium chloride competent cells for frozen storage | |||
1. Transfer 166 ul of the competent cell suspension to sterile Falcon culture tubes. | |||
2. Add 34 ul of sterile 100% glycerol to the 166 ul aliquots of the final competent cell suspension prepared above, giving a final concentration of 17 % glycerol. | |||
3. The competent cells then should be placed at -70degC and can be stored indefinately. | |||
4. To use competent cells for transformation, remove from freezer and thaw for a few minutes at 37degC. Place on ice, add plasmid DNA and incubate for one hour as in the standard transformation procedure. Then heat shock at 42degC for 2 minutes, cool briefly, add 1 ml of 2xTY and incubate for 1 hour at 37degC before spreading on plates. |
Revision as of 05:48, 26 June 2007
June 12, 2007
Primers
crp ORF (view sequence: [1])
Ggaattcgcggccgcttctagag ATGGTGCTTGGCAAACC Forward primer TmC 60
ctgcagcggccgctactagta TTAACGAGTGCCGTAAAC Reverse Primer TmC 57
xylR ORF (view sequence: [2])
Ggaattcgcggccgcttctagag CCATGTTTACTAAACGTCAC Forward primer TmC 56
ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer TmC 58
June 26, 2007
Competent cell preparation
http://www.chem.uga.edu/scottgrp/GrpProtocols/Competent_cell_preparation.htm
There are two main methods for preparation of competent bacterial cells (14) for transformation, the calcium chloride and the electroporation method. For the calcium chloride method, a glycerol cell culture stock of the respective E. coli strain is thawed and added to 50 ml of liquid media. This culture then is preincubated at 37degC for 1 hour, transferred to an incubator-shaker, and is incubated further for 2-3 hours. The cells are pelleted by centrifugation, resuspended in calcium chloride solution, and incubated in an ice-water bath. After another centrifugation step, the resulting cell pellet again is resuspended in calcium chloride to yield the final competent cell suspension. Competent cells are stored at 4degC, for up to several days.
Calcium Chloride Protocol
1. Thaw a frozen glycerol stock of the appropriate strain of E. coli, add it to an Erlenmeyer flask containing 50 ml of pre-warmed 2xTY (1) media, and pre-incubate in a 37degC water bath for 1 hour with no shaking. Further incubate for 2-3 hours at 37degC with shaking at 250 rpm.
2. Transfer 40 ml of the cells to a sterile 50 ml polypropylene centrifuge tube, and collect the cells by centrifugation at 3000 rpm for 8 minutes at 4deg C in a GPR centrifuge (Beckman) or 6000 rpm for 8 minutes at 4degC in an RC5-B centrifuge (DuPont) equipped with an SS-34 rotor. For M13-based transformation, save the remaining 10 ml of culture in an ice-water bath for later use.
3. After centrifugation, decant the supernatant and resuspend the cell pellet in one-half volume (20 ml) of cold, sterile 50 mM calcium chloride, incubate in an ice-water bath for 20 minutes, and centrifuge as before.
4. Decant the supernatant and gently resuspend the cell pellet in one-tenth volume (4 ml) of cold, sterile 50 mM calcium chloride to yield the final competent cell suspension.
Preparation of calcium chloride competent cells for frozen storage
1. Transfer 166 ul of the competent cell suspension to sterile Falcon culture tubes.
2. Add 34 ul of sterile 100% glycerol to the 166 ul aliquots of the final competent cell suspension prepared above, giving a final concentration of 17 % glycerol.
3. The competent cells then should be placed at -70degC and can be stored indefinately.
4. To use competent cells for transformation, remove from freezer and thaw for a few minutes at 37degC. Place on ice, add plasmid DNA and incubate for one hour as in the standard transformation procedure. Then heat shock at 42degC for 2 minutes, cool briefly, add 1 ml of 2xTY and incubate for 1 hour at 37degC before spreading on plates.