IGEM:PennState/Labbook/AudreyLeung

June 12, 2007

Primers

crp ORF (view sequence: [1])

Ggaattcgcggccgcttctagag ATGGTGCTTGGCAAACC Forward primer
TmC 60 

ctgcagcggccgctactagta TTAACGAGTGCCGTAAAC Reverse Primer
TmC 57

xylR ORF (view sequence: [2])

Ggaattcgcggccgcttctagag CCATGTTTACTAAACGTCAC Forward primer
TmC 56

ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer
TmC 58

June 25, 2007

Preparation of Ultra-competent Cells (Inoue Method)

Based on Inoue et al (1990), Gene, 96:23-28, with modifications --To prepare beforehand: SOB, TB

--Prepared competent cells of DB3.1 and DH5a

1. Inoculated 2ml media with cells, grew overnight
2. Inoculated 250mL SOB with O/N culture, grew at room temperature shaking until OD600=0.5 
3. Place flask on ice for 10 min.
4. Pellet cell by spinning cells at 4000rpm for 10 minutes at 4C
5. Discard supernatent, tip centrifuge tubes upside-down over paper towels
for 2 minutes to remove excess liquid
6. Spin at 4000rpm for 10 minutes at 4C
7. Gently resuspend pellet in 20mL ice-cold TB and 1.4mL DMSO (freeze O/N -20C)
8. Aliquot cells to 50ul for transformation or store at -70C (we stored at -80C)

June 26, 2007

Competent cell preparation -- Information

http://www.chem.uga.edu/scottgrp/GrpProtocols/Competent_cell_preparation.htm

http://www.ciwemb.edu/labs/koshland/Protocols/BACTERIA/ecolicells.html

Frozen Competent E.Coli Cells -- Preparation For Use

http://www.ciwemb.edu/labs/koshland/Protocols/BACTERIA/ecolicells.html

(Inoue et al., 1990 Gene 96:23)

  1. Inoculate a 5ml overnight of E.coli in LB+20 mM MgSO4.
  2. Next morning, inoculate 250 ml LB+20 mM Mg++ in a 2L flask with about 2ml
overnight culture. Grow at room temp (23°C) with good aeration (250rpm) to an 
A600 of 0.4-0.6. Temp is important--see original ref.
  3. Place cells 10 min on ice. Transfer to a sterile bottle and spin 3K, 10', 4°C.
  4. Resuspend pellet in 80 ml cold TB (swirl cells in bottle). Leave 10’/ice.
  5. Spin cells 3K, 10', 4°C.
  6. Resuspend cells in 20 ml cold TB then add 1.5 ml DMSO. Leave 10'/ice.
  7. Dispense into 220 ul and 525 ul aliquots (in cold sterile tubes) and 
freeze in dry ice/EtOH bath. Store -70°C. Typically, competency about 5X 106
cfu/ug DNA. Note, improves after freezing. Cells good for a year and counting.

To use:

  1. To 50 or 100 ul cells, add 5-50 ng DNA. Leave 30’ on ice.
  2. Heat shock, 45 sec at 42C, then chill cells on ice about 2’.
  3. Spin down (15 sec, eppendorf fuge) and remove SN. (Removing the Manganese
seems to boost efficiency about 10X) and resuspend cells in 200 ul LB.
  4. For a supercoiled plasmid, plate 1 ul of cells. For a ligation, plate 20 ul and the rest. 

TB (transformation buffer: filter sterilize and store 4°C) Product [stock] [ ]final volumes to make 100ml Pipes-NaOH pH6.7 0.5M 10 mM 2 ml CaCl2 0.5M 15 mM 3 ml KCl 2M 0.25M 12.5 ml (or 1.864g) MnCl2 1M 55 mM 5.5ml (or 1.088g) add to 100ml with ddH2O 4. To use competent cells for transformation, remove from freezer and thaw for a few minutes at 37degC. Place on ice, add plasmid DNA and incubate for one hour as in the standard transformation procedure. Then heat shock at 42degC for 2 minutes, cool briefly, add 1 ml of 2xTY and incubate for 1 hour at 37degC before spreading on plates.