IGEM:PennState/Labbook/AudreyLeung: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 171: Line 171:


<br>--Tested out SYBRGreen to PCR run
<br>--Tested out SYBRGreen to PCR run
*SYBRGreen didn't show up well (later found out due to improper storage)
*SYBRGreen didn't show up well (later found out due to improper storage of the SYBRGreen)
*Soaked gels for an our in TAE with EtBr. Saw bands for both Taq and Pfu, but very unclear (rerun next day)
*Soaked gels for an our in TAE with EtBr. Saw bands for both Taq and Pfu, but very unclear (rerun next day)

Revision as of 18:06, 3 July 2007

June 12, 2007

Primers -- crp ORF and xylR ORF

crp ORF (view sequence: [1])

Ggaattcgcggccgcttctagag ATGGTGCTTGGCAAACC Forward primer
TmC 60 
ctgcagcggccgctactagta TTAACGAGTGCCGTAAAC Reverse Primer
TmC 57

xylR ORF (view sequence: [2])

Ggaattcgcggccgcttctagag CCATGTTTACTAAACGTCAC Forward primer
TmC 56
ctgcagcggccgctactagta CTACAACATGACCTCGCTAT Reverse primer
TmC 58

June 25, 2007

Preparation of Ultra-competent Cells -- Inoue Method

Based on Inoue et al (1990), Gene, 96:23-28, with modifications
--To prepare beforehand: SOB, TB (see below)

--Prepared competent cells of DB3.1 and DH5a
--When centrifuging, centrifuge used only held max 50ml, so spun down the 250ml culture in two separate centrifuge tubes with 40ml culture (don't fill all the way to the top to prevent spilling) for ~5minutes each time.

Procedure
1. Inoculated 2ml media with cells, grew overnight
2. Inoculated 250mL SOB with O/N culture, grew at room temperature shaking until OD600=0.5 (Optimum
at 19C, but no loss of efficiency if cultures are grown at 20-23C. Doubling time is 2.5-4hours)
3. Place flask on ice for 10 min.
4. Pellet cell by spinning cells at 4000rpm for 10 minutes at 4C
5. Discard supernatent, tip centrifuge tubes upside-down over paper towels
for 2 minutes to remove excess liquid
6. Spin at 4000rpm for 10 minutes at 4C
7. Gently resuspend pellet in 20mL ice-cold TB and 1.4mL DMSO (freeze O/N -20C)
8. Aliquot cells to 50ul for transformation or store at -70C (we stored at -80C)
SOB Solution
*0.5% yeast extract
*2% tryptone
*10mM NaCl
*2.5mM KCl
*10mM MgCl2
*10mM MgSO4
*Dissolve in nanopure water and autoclave to sterilize
TB Solution
*10mM PIPES
*15mM CaCl2
*250mM KCl
*Dissolve in nanopure water and adjust pH 6.7 with KOH or HCL (solutes will dissolve as you do this) and then add
55mM MnCl2. Adjust to final volume. Sterilize by filtration with 0.45um filter and store at 4C

June 26, 2007

Competent cell preparation -- Information

http://www.chem.uga.edu/scottgrp/GrpProtocols/Competent_cell_preparation.htm

http://www.ciwemb.edu/labs/koshland/Protocols/BACTERIA/ecolicells.html

http://www.hybtech.org/Liu/uccell.html

Frozen Competent E.Coli Cells -- Preparation For Use

http://www.ciwemb.edu/labs/koshland/Protocols/BACTERIA/ecolicells.html

(Inoue et al., 1990 Gene 96:23)

  1. Inoculate a 5ml overnight of E.coli in LB+20 mM MgSO4.
  2. Next morning, inoculate 250 ml LB+20 mM Mg++ in a 2L flask with about 2ml
overnight culture. Grow at room temp (23°C) with good aeration (250rpm) to an 
A600 of 0.4-0.6. Temp is important--see original ref.
  3. Place cells 10 min on ice. Transfer to a sterile bottle and spin 3K, 10', 4°C.
  4. Resuspend pellet in 80 ml cold TB (swirl cells in bottle). Leave 10’/ice.
  5. Spin cells 3K, 10', 4°C.
  6. Resuspend cells in 20 ml cold TB then add 1.5 ml DMSO. Leave 10'/ice.
  7. Dispense into 220 ul and 525 ul aliquots (in cold sterile tubes) and 
freeze in dry ice/EtOH bath. Store -70°C. Typically, competency about 5X 106
cfu/ug DNA. Note, improves after freezing. Cells good for a year and counting.

To use:

  1. To 50 or 100 ul cells, add 5-50 ng DNA. Leave 30’ on ice.
  2. Heat shock, 45 sec at 42C, then chill cells on ice about 2’.
  3. Spin down (15 sec, eppendorf fuge) and remove SN. (Removing the Manganese
seems to boost efficiency about 10X) and resuspend cells in 200 ul LB.
  4. For a supercoiled plasmid, plate 1 ul of cells. For a ligation, plate 20 ul and the rest. 

TB (transformation buffer: filter sterilize and store 4°C) Product [stock] [ ]final volumes to make 100ml Pipes-NaOH pH6.7 0.5M 10 mM 2 ml CaCl2 0.5M 15 mM 3 ml KCl 2M 0.25M 12.5 ml (or 1.864g) MnCl2 1M 55 mM 5.5ml (or 1.088g) add to 100ml with ddH2O 4. To use competent cells for transformation, remove from freezer and thaw for a few minutes at 37degC. Place on ice, add plasmid DNA and incubate for one hour as in the standard transformation procedure. Then heat shock at 42degC for 2 minutes, cool briefly, add 1 ml of 2xTY and incubate for 1 hour at 37degC before spreading on plates.

June 27, 2007

DH5a and DB3.1 Ultra-Competent Cells -- Notes

--Finished up competent cell procedure
--DH5a cells grew very slowly, DB3.1 cells grew very fast
--Transformed fresh DB3.1 cells with P1010 (cell death gene) and pUC19 (small high copy vector)
--Plated DB3.1 (P1010, pUC19, negative control, positive control [DB3.1 on strep])

June 28, 2007

DH5a and DB3.1 Competent Cells (cont.)

--Transformed cells grew well
--Very few pUC19 cells (probably due to very small amount of vector added during transformation)
--No cells on negative control (good)
--Inoculated transformed cells into cell cultures for mini-prepping (pUC19 into 2mL, death gene into 15mL)

PCR

--PCR testing out Taq and Pfu DNA polymerase (during this experiment, thought Pfx was being used instead of Pfu) on the following primers (12 samples total))

Primers Used
*3398+3399: xyl promoter region (xylA to xylF) BBa_I741015
*3400+3401: xyl promoter region (xylF to xylA) BBa_I741017
*3406+3407: PFGH including CRP-cAMP binding site BBa_I741018
*3408+3409: PAB with CRP-cAMP binding site BBa_I741019
*3402+3403: PFGH without CRP-cAMP binding site BBa_I741020
*3404+3405: PAB without CRP-cAMP binding site BBa_I741021

--PCR from the day before didn't work because MgCl2 was used instead of MgSO4


June 29, 2007

Miniprep -- pUC19 and P1010

--Used O/N cultures to do miniprep. Miniprepped 1 tube of pUC19 and 10 tubes of P1010 (1ml, spin, add another 1ml, spin). Spun down at 4k for ~10 minutes

QIAprep Spin Miniprep
1. Resuspend pelleted bacterial cells in 250ul Buffer P1 an transfer to
microcentrifuge tube (Ensure RNase A has been added to
Buffer P1
2. Add 250ul Buffer P2 and mix thoroughly by inverting the tube 4-6 times until solution is
viscous and slightly clear. Do not vortex as doing so will shear the DNA
3. Add 350ul Buffer N3 and mix the solution thorougly by inverting the tube 4-6 times. Solution
should become cloudy
4. Centrifuge for 10min. at 13000rpm (~17900 x g)
5. Apply the supernatants from step 4 to the QIAprep spin column
6. Centrifuge for 30-60sec. Discard flowthrough
7. Wash QIAprep spin column by adding 0.75ml Buffer PE (w/EtOH) and centrifuge for 30-60sec.
Discard flowthrough
8. Centrifuge an additional 1min. to remove residual wash buffer
9. Place QIAprep column in a clean 1.5ml microcentrifuge tube. Add 50ul dH2O to the
center of each QIAprep, let stand for 1min. and centrifuge for 1min.

Transformation -- pUC19

--Transformed pUC19 into DH5a to test both competence of DH5a frozen stocks and pUC19 miniprep
--Plated 200ul on Amp plates

July 2, 2007

General Lab Activities

--Ordered Invitrogen Platinum Pfx DNA Polymerase
--Made more SOB

PCR -- Temperature Gradient Experiment

--Testing optimal temperature using temperature gradient during PCR using Taq and Pfu DNA polymerase

PCR Protocol (modified)
Reaction Mixture (10x volume)
*418ul dH2O
*50ul 10x PfuUltra HF reaction buffer or ThermolPol buffer (for Taq)
*10ul dNTP (25mM each dNTP)
*0.69 Primer #1
*0.69 Primer #2
Then aliquoted 39ul mixture into PCR tubes (8 samples, 1 negative) for each polymerase
Added 1ul of chromosomal DNA (DNA template) to all tubes except negative control
Then added 1ul of appropriate polymerase

Gradient temperatures: 55.0, 56.6, 59.0, 62.6, 67.7, 71.3, 73.6, 75.0 (in C)


--Tested out SYBRGreen to PCR run

  • SYBRGreen didn't show up well (later found out due to improper storage of the SYBRGreen)
  • Soaked gels for an our in TAE with EtBr. Saw bands for both Taq and Pfu, but very unclear (rerun next day)