IGEM:PennState/Labbook/GalenLynch/2007-6-11

From OpenWetWare

< IGEM:PennState | Labbook/GalenLynch
Revision as of 13:06, 13 June 2007 by Tachyon60 (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

June 11th, 2007: 9:30-1:00, 3:45-5:00

Note: Start codons are in green, stop codons are in read, translational terminators are in blue

XylR with promoter and rbs and terminator (right)

GCAACCAAAC GCCGTTCTTG ATTTTGATAA AAATTTTCTC AAAGCCGGTT ACGTATTACC
GGTTTTGAGT TTTTGCATGA TTCAGCAGGA AAAGAACCAT GTTTACTAAA CGTCACCGCA
TCACATTACT GTTCAATGCC AATAAAGCCT ATGACCGGCA GGTAGTAGAA GGCGTAGGGG
AATATTTACA GGCGTCACAA TCGGAATGGG ATATTTTCAT TGAAGAAGAT TTCCGCGCCC
GCATTGATAA AATCAAGGAC TGGTTAGGAG ATGGCGTCAT TGCCGACTTC GACGACAAAC
AGATCGAGCA AGCGCTGGCT GATGTCGACG TCCCCATTGT TGGGGTTGGC GGCTCGTATC
ACCTTGCAGA AAGTTACCCA CCCGTTCATT ACATTGCCAC CGATAACTAT GCGCTGGTTG
AAAGCGCATT TTTGCATTTA AAAGAGAAAG GCGTTAACCG CTTTGCTTTT TATGGTCTTC
CGGAATCAAG CGGCAAACGT TGGGCCACTG AGCGCGAATA TGCATTTCGT CAGCTTGTCG
CCGAAGAAAA GTATCGCGGA GTGGTTTATC AGGGGTTAGA AACCGCGCCA GAGAACTGGC
AACACGCGCA AAATCGGCTG GCAGACTGGC TACAAACGCT ACCACCGCAA ACCGGGATTA
TTGCCGTTAC TGACGCCCGA GCGCGGCATA TTCTGCAAGT ATGTGAACAT CTACATATTC
CCGTACCGGA AAAATTATGC GTGATTGGCA TCGATAACGA AGAACTGACC CGCTATCTGT
CGCGTGTCGC CCTTTCTTCG GTCGCTCAGG GCGCGCGGCA AATGGGCTAT CAGGCGGCAA
AACTGTTGCA TCGATTATTA GATAAAGAAG AAATGCCGCT ACAGCGAATT TTGGTCCCAC
CAGTTCGCGT CATTGAACGG CGCTCAACAG ATTATCGCTC GCTGACCGAT CCCGCCGTTA
TTCAGGCCAT GCATTACATT CGTAATCACG CCTGTAAAGG GATTAAAGTG GATCAGGTAC
TGGATGCGGT CGGGATCTCG CGCTCCAATC TTGAGAAGCG TTTTAAAGAA GAGGTGGGTG
AAACCATCCA TGCCATGATT CATGCCGAGA AGCTGGAGAA AGCGCGCAGT CTGCTGATTT
CAACCACCTT GTCGATCAAT GAGATATCGC AAATGTGCGG TTATCCATCG CTGCAATATT
TCTACTCTGT TTTTAAAAAA GCATATGACA CGACGCCAAA AGAGTATCGC GATGTAAATA
GCGAGGTCAT GTTGTAGCGA TGATGAGAAT TGTCGGCGTC ACATCAGGTA ACGCTGCGTG
GTTGTCGGAT GCGGCGTGAA CGCCTTATCC GACCTACCCG CCAGGCATGA TAAAACGCAC
CAACAACGCT TCAGGCTCGT AGCTCAACTG CCTGAGACAA AGTAAAAAGC CTTATCCGAC
TGACAAGTCG GATAAGGCTC AAGGAAATGC AAT

Primers:

ggaattcgcg gccgcttcta gag GCAACCAAAC GCCGTTCT (left side)
 Sequence for operations: ggaattcgcggccgcttctagagGCAACCAAACGCCGTTCT
  • TmC 63,81
ctgcagcggc cgctactagt a  ATTGCATTTC CTTGAGCCTT ATCC (right side)
 Sequence for operations: ctgcagcggccgctactagtaATTGCATTTCCTTGAGCCTTATCC
  • TmC 63,78

XylR with promoter and rbs (left)

ATTGCATTTC CTTGAGCCTT ATCCGACTTG TCAGTCGGAT AAGGCTTTTT ACTTTGTCTC
AGGCAGTTGA GCTACGAGCC TGAAGCGTTG TTGGTGCGTT TTATCATGCC TGGCGGGTAG
GTCGGATAAG GCGTTCACGC CGCATCCGAC AACCACGCAG CGTTACCTGA TGTGACGCCG
ACAATTCTCA TCATCGCTAC AACATGACCT CGCTATTTAC ATCGCGATAC TCTTTTGGCG
TCGTGTCATA TGCTTTTTTA AAAACAGAGT AGAAATATTG CAGCGATGGA TAACCGCACA
TTTGCGATAT CTCATTGATC GACAAGGTGG TTGAAATCAG CAGACTGCGC GCTTTCTCCA
GCTTCTCGGC ATGAATCATG GCATGGATGG TTTCACCCAC CTCTTCTTTA AAACGCTTCT
CAAGATTGGA GCGCGAGATC CCGACCGCAT CCAGTACCTG ATCCACTTTA ATCCCTTTAC
AGGCGTGATT ACGAATGTAA TGCATGGCCT GAATAACGGC GGGATCGGTC AGCGAGCGAT
AATCTGTTGA GCGCCGTTCA ATGACGCGAA CTGGTGGGAC CAAAATTCGC TGTAGCGGCA
TTTCTTCTTT ATCTAATAAT CGATGCAACA GTTTTGCCGC CTGATAGCCC ATTTGCCGCG
CGCCCTGAGC GACCGAAGAA AGGGCGACAC GCGACAGATA GCGGGTCAGT TCTTCGTTAT
CGATGCCAAT CACGCATAAT TTTTCCGGTA CGGGAATATG TAGATGTTCA CATACTTGCA
GAATATGCCG CGCTCGGGCG TCAGTAACGG CAATAATCCC GGTTTGCGGT GGTAGCGTTT
GTAGCCAGTC TGCCAGCCGA TTTTGCGCGT GTTGCCAGTT CTCTGGCGCG GTTTCTAACC
CCTGATAAAC CACTCCGCGA TACTTTTCTT CGGCGACAAG CTGACGAAAT GCATATTCGC
GCTCAGTGGC CCAACGTTTG CCGCTTGATT CCGGAAGACC ATAAAAAGCA AAGCGGTTAA
CGCCTTTCTC TTTTAAATGC AAAAATGCGC TTTCAACCAG CGCATAGTTA TCGGTGGCAA
TGTAATGAAC GGGTGGGTAA CTTTCTGCAA GGTGATACGA GCCGCCAACC CCAACAATGG
GGACGTCGAC ATCAGCCAGC GCTTGCTCGA TCTGTTTGTC GTCGAAGTCG GCAATGACGC
CATCTCCTAA CCAGTCCTTG ATTTTATCAA TGCGGGCGCG GAAATCTTCT TCAATGAAAA
TATCCCATTC CGATTGTGAC GCCTGTAAAT ATTCCCCTAC GCCTTCTACT ACCTGCCGGT
CATAGGCTTT ATTGGCATTG AACAGTAATG TGATGCGGTG ACGTTTAGTA AACATGGTTC
TTTTCCTGCT GAATCATGCA AAAACTCAAA ACCGGTAATA CGTAACCGGC TTTGAGAAAA
TTTTTATCAA AATCAAGAAC GGCGTTTGGT TGC

Primers:

ggaattcgcg gccgcttcta gag ATTGCATTTC CTTGAGCCTT ATCC (right side)
 Sequence for operations: ggaattcgcggccgcttctagagATTGCATTTCCTTGAGCCTTATCC
  • TmC 63,79
ctgcagcggc cgctactagt a  GCAACCAAAC GCCGTTCT (left side)
 Sequence for operations: ctgcagcggccgctactagtaGCAACCAAACGCCGTTCT
  • TmC 63,80

XylR open reading frame (right)

ATGTTTACTA AACGTCACCG CATCACATTA CTGTTCAATG CCAATAAAGC CTATGACCGG
CAGGTAGTAG AAGGCGTAGG GGAATATTTA CAGGCGTCAC AATCGGAATG GGATATTTTC
ATTGAAGAAG ATTTCCGCGC CCGCATTGAT AAAATCAAGG ACTGGTTAGG AGATGGCGTC
ATTGCCGACT TCGACGACAA ACAGATCGAG CAAGCGCTGG CTGATGTCGA CGTCCCCATT
GTTGGGGTTG GCGGCTCGTA TCACCTTGCA GAAAGTTACC CACCCGTTCA TTACATTGCC
ACCGATAACT ATGCGCTGGT TGAAAGCGCA TTTTTGCATT TAAAAGAGAA AGGCGTTAAC
CGCTTTGCTT TTTATGGTCT TCCGGAATCA AGCGGCAAAC GTTGGGCCAC TGAGCGCGAA
TATGCATTTC GTCAGCTTGT CGCCGAAGAA AAGTATCGCG GAGTGGTTTA TCAGGGGTTA
GAAACCGCGC CAGAGAACTG GCAACACGCG CAAAATCGGC TGGCAGACTG GCTACAAACG
CTACCACCGC AAACCGGGAT TATTGCCGTT ACTGACGCCC GAGCGCGGCA TATTCTGCAA
GTATGTGAAC ATCTACATAT TCCCGTACCG GAAAAATTAT GCGTGATTGG CATCGATAAC
GAAGAACTGA CCCGCTATCT GTCGCGTGTC GCCCTTTCTT CGGTCGCTCA GGGCGCGCGG
CAAATGGGCT ATCAGGCGGC AAAACTGTTG CATCGATTAT TAGATAAAGA AGAAATGCCG
CTACAGCGAA TTTTGGTCCC ACCAGTTCGC GTCATTGAAC GGCGCTCAAC AGATTATCGC
TCGCTGACCG ATCCCGCCGT TATTCAGGCC ATGCATTACA TTCGTAATCA CGCCTGTAAA
GGGATTAAAG TGGATCAGGT ACTGGATGCG GTCGGGATCT CGCGCTCCAA TCTTGAGAAG
CGTTTTAAAG AAGAGGTGGG TGAAACCATC CATGCCATGA TTCATGCCGA GAAGCTGGAG
AAAGCGCGCA GTCTGCTGAT TTCAACCACC TTGTCGATCA ATGAGATATC GCAAATGTGC
GGTTATCCAT CGCTGCAATA TTTCTACTCT GTTTTTAAAA AAGCATATGA CACGACGCCA
AAAGAGTATC GCGATGTAAA TAGCGAGGTC ATGTTGTAG

Primers:

 ggaattcgcg gccgcttcta gag ATGTTTACTA AACGTCACCG CATCA left side
  Sequence without spaces: ggaattcgcggccgcttctagagATGTTTACTAAACGTCACCGCATCA
  • TmC 65,79
 ctgcagcggc cgctactagt a CTACAACATG ACCTCGCTAT TTACAT right side
  Sequence wihout spaces: ctgcagcggccgctactagtaCTACAACATGACCTCGCTATTTACAT
  • TmC 62,77

XylR open reading frame (left)

CTACAACATG ACCTCGCTAT TTACATCGCG ATACTCTTTT GGCGTCGTGT CATATGCTTT
TTTAAAAACA GAGTAGAAAT ATTGCAGCGA TGGATAACCG CACATTTGCG ATATCTCATT
GATCGACAAG GTGGTTGAAA TCAGCAGACT GCGCGCTTTC TCCAGCTTCT CGGCATGAAT
CATGGCATGG ATGGTTTCAC CCACCTCTTC TTTAAAACGC TTCTCAAGAT TGGAGCGCGA
GATCCCGACC GCATCCAGTA CCTGATCCAC TTTAATCCCT TTACAGGCGT GATTACGAAT
GTAATGCATG GCCTGAATAA CGGCGGGATC GGTCAGCGAG CGATAATCTG TTGAGCGCCG
TTCAATGACG CGAACTGGTG GGACCAAAAT TCGCTGTAGC GGCATTTCTT CTTTATCTAA
TAATCGATGC AACAGTTTTG CCGCCTGATA GCCCATTTGC CGCGCGCCCT GAGCGACCGA
AGAAAGGGCG ACACGCGACA GATAGCGGGT CAGTTCTTCG TTATCGATGC CAATCACGCA
TAATTTTTCC GGTACGGGAA TATGTAGATG TTCACATACT TGCAGAATAT GCCGCGCTCG
GGCGTCAGTA ACGGCAATAA TCCCGGTTTG CGGTGGTAGC GTTTGTAGCC AGTCTGCCAG
CCGATTTTGC GCGTGTTGCC AGTTCTCTGG CGCGGTTTCT AACCCCTGAT AAACCACTCC
GCGATACTTT TCTTCGGCGA CAAGCTGACG AAATGCATAT TCGCGCTCAG TGGCCCAACG
TTTGCCGCTT GATTCCGGAA GACCATAAAA AGCAAAGCGG TTAACGCCTT TCTCTTTTAA
ATGCAAAAAT GCGCTTTCAA CCAGCGCATA GTTATCGGTG GCAATGTAAT GAACGGGTGG
GTAACTTTCT GCAAGGTGAT ACGAGCCGCC AACCCCAACA ATGGGGACGT CGACATCAGC
CAGCGCTTGC TCGATCTGTT TGTCGTCGAA GTCGGCAATG ACGCCATCTC CTAACCAGTC
CTTGATTTTA TCAATGCGGG CGCGGAAATC TTCTTCAATG AAAATATCCC ATTCCGATTG
TGACGCCTGT AAATATTCCC CTACGCCTTC TACTACCTGC CGGTCATAGG CTTTATTGGC
ATTGAACAGT AATGTGATGC GGTGACGTTT AGTAAACAT


Primers:

 ggaattcgcggccgcttctagag CTACAACATG ACCTCGCTAT TTACAT left side
  Sequence for operations: ggaattcgcggccgcttctagagCTACAACATGACCTCGCTATTTACAT
  • TmC 62,78
 ctgcagcggccgctactagta ATGTTTACTA AACGTCACCG CATCA right side
  Sequence for operations: ctgcagcggccgctactagtaATGTTTACTAAACGTCACCGCATCA
  • TmC 65,78


Galen Lynch's Lab Notebook

Personal tools