IGEM:PennState/Labbook/NoahJohnson

From OpenWetWare

< IGEM:PennState(Difference between revisions)
Jump to: navigation, search
Current revision (15:50, 15 April 2008) (view source)
 
(40 intermediate revisions not shown.)
Line 1: Line 1:
-
<h1 style="color: #AAAAAA">'''[[User:nrj5011|Noah Johnson]] Lab Notebook'''</h1>
+
<h1>[[user:nrj5011|Noah Johnson]]</h1>
 +
 
*Penn State iGEM 2007
*Penn State iGEM 2007
**[[http://openwetware.org/wiki/IGEM:PennState iGEM 2007]]
**[[http://openwetware.org/wiki/IGEM:PennState iGEM 2007]]
-
*Penn State Undergraduate
+
*Penn State Undergraduate - BioEngineering
*Email [mailto:nrj5011@psu.edu nrj5011@psu.edu]
*Email [mailto:nrj5011@psu.edu nrj5011@psu.edu]
-
*Phone
+
*Phone (814) 441 2037
 +
 
 +
<h2>'''Calender'''</h2>
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2007/04/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2007/07/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2007/10/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2008/01/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2008/04/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 
 +
<h2>[<span class="_togglegroup _toggle _toggler">April 30, 2007-Bacterial Conjugation Presentation</span><span class="_toggle _toggler" style="display:none;">April 30, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">Project Proposal: Bacterial Conjugation</span><span class="_toggle _toggler" style="display:none;">Close Project Proposal: Bacterial Conjugation</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
<table|left>
 +
 
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011conjugation1.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011conjugation2.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011conjugation3.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011conjugation4.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011conjugation5.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011conjugation6.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011conjugation7.jpg|thumb|]]</td>
 +
  </tr>
 +
</table>
 +
</div>
 +
</div>
 +
 
 +
<h2>[<span class="_togglegroup _toggle _toggler">May 24, 2007-Restriction Digest</span><span class="_toggle _toggler" style="display:none;">May 24, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">Restriction Digest</span><span class="_toggle _toggler" style="display:none;">Close Restriction Digest</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
#Insert A,B,C
 +
#*3.5 H20
 +
#*3.5 DNA (J23038: A (LW0006 LW-1),B (LW0007 LW-1),C (LW0008 LW-1))
 +
#*1 EcoR1 Buf
 +
#*1 BSA
 +
#*0.5 EcoR1
 +
#*0.5 SpeI
 +
#Vector A,B,C
 +
#*3.5 H20
 +
#*3.5 DNA (J31004: A (LW0003 LW-1),B (LW0004 LW-1),C (LW0005 LW-1))
 +
#*1 EcoR1 Buf(!WRONG:Should have been Buffer 2!)
 +
#*1 BSA
 +
#*0.5 EcoR1
 +
#*0.5 XbaI
 +
#Vector -
 +
#*6.5 H2O
 +
#*3.5 DNA (J31004: A (LW0003 LW-1))
 +
#EcoR1 Vector
 +
#*4 H2O
 +
#*3.5 DNA (J31004: A (LW0003 LW-1))
 +
#*1 EcoR1 Buf
 +
#*1 BSA
 +
#*0.5 EcoR1
 +
#XbaI Vector
 +
#*4 H2O
 +
#*3.5 DNA (J31004: A (LW0003 LW-1))
 +
#*1 Buffer 2
 +
#*1 BSA
 +
#*0.5 Xba
 +
#SpeI Vector
 +
#*4 H2O
 +
#*3.5 DNA (J31004: A (LW0003 LW-1))
 +
#*1 Buffer 2
 +
#*1 BSA
 +
#*0.5 SpeI
 +
 
 +
</div>
 +
</div>
 +
 
 +
<h2>[<span class="_togglegroup _toggle _toggler">May 30, 2007-Biofilms Presentation</span><span class="_toggle _toggler" style="display:none;">May 30, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">Project Proposal: Biofilms</span><span class="_toggle _toggler" style="display:none;">Close Project Proposal: Biofilms</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
<table|left>
 +
 
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011biofilms1.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011biofilms2.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011biofilms3.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011biofilms4.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011biofilms5.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011biofilms6.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011biofilms7.jpg|thumb|]]</td>
 +
  </tr>
 +
</table>
 +
 
 +
</div>
 +
</div>
 +
 
 +
<h2>[<span class="_togglegroup _toggle _toggler">June 4, 2007-iGEM Meeting Presentation</span><span class="_toggle _toggler" style="display:none;">June 4, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">iGEM Meeting Presentation</span><span class="_toggle _toggler" style="display:none;">iGEM Meeting Presentation</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
<table|left>
 +
 
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011june041.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011june042.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011june043.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011june044.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011june045.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011june046.jpg|thumb|]]</td>
 +
</tr>
 +
<tr>
 +
  <td>[[Image:psuigemnrj5011june047.jpg|thumb|]]</td>
 +
  <td>[[Image:psuigemnrj5011june048.jpg|thumb|]]</td>
 +
  </tr>
 +
</table>
 +
 
 +
</div>
 +
</div>
 +
 
 +
<h2>[<span class="_togglegroup _toggle _toggler">June 11, 2007-Primer Sequencing</span><span class="_toggle _toggler" style="display:none;">June 11, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">XylA,B Primer</span><span class="_toggle _toggler" style="display:none;">XylA,B Primer</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
3725940-3728788 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11074 Ecocyc]
 +
 
 +
<html><pre>
 +
TTACGCCATT AATGGCAGAA GTTGCTGATA GAGGCGACGG AACGTTTCTC GTCGTGGCTG
 +
ATAAGCGGCA TAACGCTGCG CATCTGGTAG ATGCGACTGT TCTAACGGTA GTTGCGGCAA
 +
CAATTCAATG AGCGATTTCT CTGGATTCGC CGCGATCTGC GCCAGCCTTG CTGCGCCCAG
 +
TGCTGGCCCC ACATCCCCCC CCGTACGGTA ATCGAGCTGC TGACCGCTGA TATCCGCCAG
 +
CATCTGACGC CAGTACTCAC TACGCGCCCC GCCCCCAATC AACGTAACAC TTTGCGGTTT
 +
AATACCGCAG GCATGCACGA CATCCATGCC ATCTGCCAGC GCATAACCCA CGCCTTCCAG
 +
CACTGCTCGC GCCAGTTCAT TGGGGCCATG TTGATGAGTC AAACCAAAGA AAACCCCCTT
 +
CGCCTGGGGA TTATTGTGTG GCGTACGCTC GCCGGAAAGA TAAGGCAGAA ACCAAACTGG
 +
CTCGGCACTT TCATCAGCCT GTTGAGCTGC AGCGATTAAA GCTGGGACAT TGCTCAGGCC
 +
GGTTAATTTC GCGGCCCAAT CCAGACACGA CGCTGCACTC AGCATCACAG ACATTAAATG
 +
CCAACGTTGC GGTAGCGCAT GGCAAAAGCT ATGTACGGCG CTTTCTGGCT TGCTTAAGAA
 +
CCCTTCGCTG ACAGCAAAAT AGACCCCCGA CGTCCCCAGC GATAACATTG CCTGATTAGC
 +
ATCAACCATT CCCACACCAA CTGCACCAGC TGCATTGTCG CCACCGCCTG CGACAACTGG
 +
CACCGTCGCC ATACCCCACG CTTTCGCAAC TTCAGGTAAC AAAGCACCAG TAATTTCGCT
 +
GCCTTCGTAT AATGCGGGCA TCTGGTCACG AGATAAGTCG CAAGCCTGCA GCATGACGTC
 +
ACTCCAGTCA CGCTTTGCGA CATCCAGCCA CATGGTGCCA GCTGCGTCAG ACATATCGCT
 +
GGCAAACTCC CCCGTCATAC GCAGACGCAA GTAATCTTTC GGTAATAATA CTTTGTCGAT
 +
TTGACGGAAT ATCTCCGGCT CATGCCGCTG AACCCATAGC AATTTAGGCG CAGTAAATCC
 +
GGGCATCATC AGGTTGCCGG TAATCACCCG CGATTGCGGA ACTCGCGCTT CCAGCAAAGT
 +
GCACTCTTGC GCACAGCGCC CGTCGTTCCA CAAAATGGCA GGGCGTAACA CCCGTTGCTG
 +
AGCATCCAGC AAGGTTGCTC CGTGCATCTG GCCGGCAATA CCCAATGCTT TAACGTCCTG
 +
CAGAGAATGC TGATCGCCCA GAGCTTTCAT TGCGCGATCA GTTGCCTGCC ACCACTGTTC
 +
CGGGTCTTGT TCCGACCAGA GTGGATGCGG GCGCGAAACG GTCAGCTTTT CCGTTTGCGC
 +
AGCAACCACC TCACCCTGCT CGTTGAGCAA AATAACTTTT ACGCCCGAGG TGCCAAGATC
 +
TATCCCGATA TACATATCGA TCGTTCCTTA AAAAAATGCC CGGTATCGCT ACCGATAACC
 +
GGGCCAACGG ACTGCACAGT TAGCCGTTAT TTGTCGAACA GATAATGGTT TACCAGATTT
 +
TCCAGTTGTT CCTGGCGACC ACTCTGATGC ACCGGAGACA AATGATGTTC CTGAGCATAT
 +
TTGGCTAAAT CTGCCAGTGA CATTTGGCCT TTCAGGATTT GCTGGCCCAA TTCGCTATTC
 +
CAGCCGGAAT AACGCTGCGC GATGCGTTTA TCCAGCTCGC CATCTTCAAT CATGCGCGCT
 +
GCAATTTTCA GCGCCAGTGC CATCGTATCC ATCGCGCCGA TATGACCGTA AAACAGATCA
 +
TATTTATCAG TACTTTGACG ACGTACTTTG GCATCGAAGT TCAGACCACC GGTGGTGAAA
 +
CCGCCTGCTT TGAGAATTTC ATACATCACC AGCGCATTCT CTTCCACACT GTTCGGGAAC
 +
TGGTCGGTGT CCCAGCCCAG TTGCGCATCG CCACGGTTGG CGTCGACAGA ACCGAACAGG
 +
CCAAGCGCAA TGGCGGTGGC TATTTCATGA TGGAAAGAGT GACCTGCCAG CGTCGCGTGG
 +
TTAGCTTCAA TGTTCAGTTT AATCTCTTTT TCCAGACCAA ACTGTTTCAG GAAGCCATAG
 +
ACCGTCGCGG CATCGTAATC ATATTGATGT TTGGTCGGTT CTTGCGGTTT CGGTTCGATA
 +
AGCAACGTGC CCTGGAAACC GATTTTATGT TTATGCTCAA CCACCATCTG CATAAAGCGG
 +
CCCAGTTGTT CACGCTCCTG ACGCAAGTCG GTATTTAACA GCGTTTCGTA ACCTTCACGA
 +
CCGCCCCACA GGACATAGTT TTCACCGCCC AATTTATGGG TTGCTTCCAT CGCTGTAACA
 +
ACTTGCGTTG CCGCCCAGCT GAAGACTTCA GGATCTGGGT TCGTCGCCGC ACCCGCGCCG
 +
TAGCGAGGGT TTGTAAAGCA GTTGGCCGTT CCCCACAGCA GCTTCACGCC GCTCTCTTCT
 +
TGCTTGCCTG CCAGGACATC AACCATTTGC GCAAAATTAT TGATGTACTC TTTTAACGAC
 +
GCGCCCTCAG GGGAAACATC CACATCGTGG AAGCAATAAA ATGGCACATG TAACTTGTGG
 +
AAAAACTCAA ATGCGACATC TGCTTTACGC TTCGCCAACG CCAGTGCCTC ACCAGGCTGC
 +
TGCCACGGAC GATTAAACGC CCCCACACCA AACATATCCG CCCCGTTCCA GCAGAAGGTG
 +
TGCCAGTAGC AGGCGGCAAA ACGCAAGTGC TCTTCCATAC GCTTACCCAA CACCAGTTCG
 +
TCGGGATTGT AGTGACGGAA TGCTAACGGG TTTGAGGATT TTGAGCCTTC ATAACGAACG
 +
CGATCGAGCT GGTCAAAATA GGCTTGCAT</pre></html>
 +
 
 +
Left side primer:  gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA
 +
 
 +
Right side primer:  ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA
 +
 
 +
</div>
 +
 
 +
[<span class="_togglegroup _toggle _toggler">XylR Promoter Region Primer</span><span class="_toggle _toggler" style="display:none;">XylR Promoter Region Primer</span>]
 +
<div class="_toggle" style="display:none;">
 +
 
 +
 
 +
3732905-3733001 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG20253 Ecocyc]
 +
 
 +
<html><pre>CAACCAAACG CCGTTCTTGA TTTTGATAAA AATTTTCTCA AAGCCGGTTA CGTATTACCG
 +
GTTTTGAGTT TTTGCATGAT TCAGCAGGAA AAGAACC</pre></html>
 +
 
 +
Left side primer:  gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA
 +
 
 +
Right side primer:  ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC
 +
 
 +
</div>
 +
</div>

Current revision

Contents

Noah Johnson

Calender

March
SMTWTFS
123
45678910
11121314151617
18192021222324
25262728293031
April
SMTWTFS
1234567
891011121314
15161718192021
22232425262728
2930
May
SMTWTFS
12345
6789101112
13141516171819
20212223242526
2728293031


June
SMTWTFS
12
3456789
10111213141516
17181920212223
24252627282930
July
SMTWTFS
1234567
891011121314
15161718192021
22232425262728
293031
August
SMTWTFS
1234
567891011
12131415161718
19202122232425
262728293031


September
SMTWTFS
1
2345678
9101112131415
16171819202122
23242526272829
30
October
SMTWTFS
123456
78910111213
14151617181920
21222324252627
28293031
November
SMTWTFS
123
45678910
11121314151617
18192021222324
252627282930


December
SMTWTFS
1
2345678
9101112131415
16171819202122
23242526272829
3031
January
SMTWTFS
12345
6789101112
13141516171819
20212223242526
2728293031
February
SMTWTFS
12
3456789
10111213141516
17181920212223
242526272829


March
SMTWTFS
1
2345678
9101112131415
16171819202122
23242526272829
3031
April
SMTWTFS
12345
6789101112
13141516171819
20212223242526
27282930
May
SMTWTFS
123
45678910
11121314151617
18192021222324
25262728293031


[April 30, 2007-Bacterial Conjugation Presentation]

[May 24, 2007-Restriction Digest]

[May 30, 2007-Biofilms Presentation]

[June 4, 2007-iGEM Meeting Presentation]

[June 11, 2007-Primer Sequencing]

Personal tools