
From OpenWetWare

< IGEM:PennState(Difference between revisions)
Jump to: navigation, search
Current revision (15:50, 15 April 2008) (view source)
(33 intermediate revisions not shown.)
Line 1: Line 1:
<h1>[[user:nrj5011|Noah Johnson]]</h1>
*Penn State iGEM 2007
**[[http://openwetware.org/wiki/IGEM:PennState iGEM 2007]]
*Penn State Undergraduate - BioEngineering
*Email [mailto:nrj5011@psu.edu nrj5011@psu.edu]
*Phone (814) 441 2037
name=Noah's 2007 iGEM Notebook
Line 8: Line 17:
name=Noah's 2007 iGEM Notebook
<h2>[<span class="_togglegroup _toggle _toggler">April 30, 2007-Bacterial Conjugation Presentation</span><span class="_toggle _toggler" style="display:none;">April 30, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">Project Proposal: Bacterial Conjugation</span><span class="_toggle _toggler" style="display:none;">Close Project Proposal: Bacterial Conjugation</span>]
<div class="_toggle" style="display:none;">
<h2>[<span class="_togglegroup _toggle _toggler">May 24, 2007-Restriction Digest</span><span class="_toggle _toggler" style="display:none;">May 24, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">Restriction Digest</span><span class="_toggle _toggler" style="display:none;">Close Restriction Digest</span>]
<div class="_toggle" style="display:none;">
#Insert A,B,C
#*3.5 H20
#*3.5 DNA (J23038: A (LW0006 LW-1),B (LW0007 LW-1),C (LW0008 LW-1))
#*1 EcoR1 Buf
#*1 BSA
#*0.5 EcoR1
#*0.5 SpeI
#Vector A,B,C
#*3.5 H20
#*3.5 DNA (J31004: A (LW0003 LW-1),B (LW0004 LW-1),C (LW0005 LW-1))
#*1 EcoR1 Buf(!WRONG:Should have been Buffer 2!)
#*1 BSA
#*0.5 EcoR1
#*0.5 XbaI
#Vector -
#*6.5 H2O
#*3.5 DNA (J31004: A (LW0003 LW-1))
#EcoR1 Vector
#*4 H2O
#*3.5 DNA (J31004: A (LW0003 LW-1))
#*1 EcoR1 Buf
#*1 BSA
#*0.5 EcoR1
#XbaI Vector
#*4 H2O
#*3.5 DNA (J31004: A (LW0003 LW-1))
#*1 Buffer 2
#*1 BSA
#*0.5 Xba
#SpeI Vector
#*4 H2O
#*3.5 DNA (J31004: A (LW0003 LW-1))
#*1 Buffer 2
#*1 BSA
#*0.5 SpeI
<h2>[<span class="_togglegroup _toggle _toggler">May 30, 2007-Biofilms Presentation</span><span class="_toggle _toggler" style="display:none;">May 30, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">Project Proposal: Biofilms</span><span class="_toggle _toggler" style="display:none;">Close Project Proposal: Biofilms</span>]
<div class="_toggle" style="display:none;">
<h2>[<span class="_togglegroup _toggle _toggler">June 4, 2007-iGEM Meeting Presentation</span><span class="_toggle _toggler" style="display:none;">June 4, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">iGEM Meeting Presentation</span><span class="_toggle _toggler" style="display:none;">iGEM Meeting Presentation</span>]
<div class="_toggle" style="display:none;">
<h2>[<span class="_togglegroup _toggle _toggler">June 11, 2007-Primer Sequencing</span><span class="_toggle _toggler" style="display:none;">June 11, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">XylA,B Primer</span><span class="_toggle _toggler" style="display:none;">XylA,B Primer</span>]
<div class="_toggle" style="display:none;">
3725940-3728788 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11074 Ecocyc]
Left side primer:  gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA
Right side primer:  ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA
[<span class="_togglegroup _toggle _toggler">XylR Promoter Region Primer</span><span class="_toggle _toggler" style="display:none;">XylR Promoter Region Primer</span>]
<div class="_toggle" style="display:none;">
3732905-3733001 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG20253 Ecocyc]
Left side primer:  gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA
Right side primer:  ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC

Current revision


Noah Johnson







[April 30, 2007-Bacterial Conjugation Presentation]

[May 24, 2007-Restriction Digest]

[May 30, 2007-Biofilms Presentation]

[June 4, 2007-iGEM Meeting Presentation]

[June 11, 2007-Primer Sequencing]

Personal tools