
From OpenWetWare

< IGEM:PennState(Difference between revisions)
Jump to: navigation, search
Current revision (14:50, 15 April 2008) (view source)
(8 intermediate revisions not shown.)
Line 1: Line 1:
<h1>Noah Johnson</h1>
<h1>[[user:nrj5011|Noah Johnson]]</h1>
*Penn State iGEM 2007
*Penn State iGEM 2007
Line 27: Line 27:
Line 151: Line 167:
<h2>[<span class="_togglegroup _toggle _toggler">June 6, 2007-Research</span><span class="_toggle _toggler" style="display:none;">June 6, 2007</span>]</h2>
<h2>[<span class="_togglegroup _toggle _toggler">June 11, 2007-Primer Sequencing</span><span class="_toggle _toggler" style="display:none;">June 11, 2007</span>]</h2>
<div class="_toggle" style="display:none;">
[<span class="_togglegroup _toggle _toggler">XylA,B Primer</span><span class="_toggle _toggler" style="display:none;">XylA,B Primer</span>]
  <div class="_toggle" style="display:none;">
  <div class="_toggle" style="display:none;">
*Moved things into Richard Lab
3725940-3728788 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11074 Ecocyc]
*Researched diauxie project, read papers listed on ANGEL
*Updated Online Lab Notebook
Left side primer:  gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA
Right side primer:  ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA
[<span class="_togglegroup _toggle _toggler">XylR Promoter Region Primer</span><span class="_toggle _toggler" style="display:none;">XylR Promoter Region Primer</span>]
<div class="_toggle" style="display:none;">
3732905-3733001 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG20253 Ecocyc]
Left side primer:  gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA
Right side primer:  ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC

Current revision


Noah Johnson







[April 30, 2007-Bacterial Conjugation Presentation]

[May 24, 2007-Restriction Digest]

[May 30, 2007-Biofilms Presentation]

[June 4, 2007-iGEM Meeting Presentation]

[June 11, 2007-Primer Sequencing]

Personal tools